Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400468558:

Variant ID: vg0400468558 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 468558
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAAAATGGCGAGGCCCAAAATTTCCAAACAATAGCATTTCTCAACTTAAAATGTCATACGTGAAGCTAAAATTACATATGTAATTTGGGATTTACATG[G/A,T]
TAAATACACTAAAATTACATATATAATTTAGTGACTAACAATGTAAATATATGATGACTATTTTTTCATGAAAAATATGACGGCATAAATATGAGAAAAT

Reverse complement sequence

ATTTTCTCATATTTATGCCGTCATATTTTTCATGAAAAAATAGTCATCATATATTTACATTGTTAGTCACTAAATTATATATGTAATTTTAGTGTATTTA[C/T,A]
CATGTAAATCCCAAATTACATATGTAATTTTAGCTTCACGTATGACATTTTAAGTTGAGAAATGCTATTGTTTGGAAATTTTGGGCCTCGCCATTTTAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	4.50%	0.02%	0.00%	T: 0.21%
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	86.10%	13.80%	0.07%	0.00%	NA
Aus	269	96.30%	0.00%	0.00%	0.00%	T: 3.72%
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	73.10%	26.70%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400468558	G -> A	LOC_Os04g01690.1	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:71.21; most accessible tissue: Callus, score: 85.873	N	N	N	N
vg0400468558	G -> A	LOC_Os04g01710.1	downstream_gene_variant ; 2542.0bp to feature; MODIFIER	silent_mutation	Average:71.21; most accessible tissue: Callus, score: 85.873	N	N	N	N
vg0400468558	G -> A	LOC_Os04g01690.2	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:71.21; most accessible tissue: Callus, score: 85.873	N	N	N	N
vg0400468558	G -> A	LOC_Os04g01690.3	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:71.21; most accessible tissue: Callus, score: 85.873	N	N	N	N
vg0400468558	G -> A	LOC_Os04g01690-LOC_Os04g01710	intergenic_region ; MODIFIER	silent_mutation	Average:71.21; most accessible tissue: Callus, score: 85.873	N	N	N	N
vg0400468558	G -> T	LOC_Os04g01690.1	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:71.21; most accessible tissue: Callus, score: 85.873	N	N	N	N
vg0400468558	G -> T	LOC_Os04g01710.1	downstream_gene_variant ; 2542.0bp to feature; MODIFIER	silent_mutation	Average:71.21; most accessible tissue: Callus, score: 85.873	N	N	N	N
vg0400468558	G -> T	LOC_Os04g01690.2	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:71.21; most accessible tissue: Callus, score: 85.873	N	N	N	N
vg0400468558	G -> T	LOC_Os04g01690.3	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:71.21; most accessible tissue: Callus, score: 85.873	N	N	N	N
vg0400468558	G -> T	LOC_Os04g01690-LOC_Os04g01710	intergenic_region ; MODIFIER	silent_mutation	Average:71.21; most accessible tissue: Callus, score: 85.873	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400468558	7.61E-09	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	1.91E-07	1.68E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	1.15E-08	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	1.40E-06	8.40E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	3.16E-06	NA	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	8.88E-10	NA	mr1586	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	5.90E-07	1.99E-07	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	2.35E-09	NA	mr1670	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	2.81E-07	2.81E-07	mr1670	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	2.77E-10	NA	mr1672	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	1.27E-06	1.72E-06	mr1672	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	5.74E-08	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	1.56E-06	1.15E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	5.83E-10	2.09E-07	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	7.35E-08	1.82E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	3.67E-22	NA	mr1670_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	5.59E-13	5.59E-13	mr1670_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	2.11E-27	NA	mr1672_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	5.50E-19	1.58E-15	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	1.67E-06	NA	mr1765_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400468558	8.73E-06	5.28E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251