RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0400455317:

Variant ID: vg0400455317 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 455317
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATTGAGTCTCGTTTTCCGCGCGCACGCTTTTCAAACTACTAAATGATGCGTTTTTTTTAAAAAAAATTTCTATAGGAAAGTTGCTTTAAAAAATCATAT[C/T]
AATCTATTTTTAAAATTTAAAATAGTTAATACTTAATTAATCATGAGCTAATGGCTCACCTCGTTTTGCGTATCTTGTCAATCTCTTTAATCCTCTTCTC

Reverse complement sequence

GAGAAGAGGATTAAAGAGATTGACAAGATACGCAAAACGAGGTGAGCCATTAGCTCATGATTAATTAAGTATTAACTATTTTAAATTTTAAAAATAGATT[G/A]
ATATGATTTTTTAAAGCAACTTTCCTATAGAAATTTTTTTTAAAAAAAACGCATCATTTAGTAGTTTGAAAAGCGTGCGCGCGGAAAACGAGACTCAATC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.50%	14.40%	0.08%	0.00%	NA
All Indica	2759	97.10%	2.90%	0.07%	0.00%	NA
All Japonica	1512	62.00%	37.90%	0.13%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	96.80%	3.00%	0.22%	0.00%	NA
Indica Intermediate	786	94.50%	5.50%	0.00%	0.00%	NA
Temperate Japonica	767	88.70%	11.30%	0.00%	0.00%	NA
Tropical Japonica	504	32.10%	67.50%	0.40%	0.00%	NA
Japonica Intermediate	241	39.40%	60.60%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400455317	C -> T	LOC_Os04g01674.1	intron_variant ; MODIFIER	silent_mutation	Average:65.024; most accessible tissue: Minghui63 root, score: 79.954	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400455317	NA	1.72E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400455317	NA	2.57E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400455317	NA	2.20E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400455317	NA	1.48E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400455317	NA	1.11E-11	mr1563	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400455317	NA	2.78E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400455317	NA	2.16E-14	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400455317	NA	3.33E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400455317	NA	3.73E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400455317	NA	3.20E-20	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 28 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0400455317:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact