\
| Variant ID: vg0400454931 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 454931 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 227. )
CTTGCTGGCCCAAAATTATGATAGTGTTTAAGATAGATTAAGATCGAGCTTAGCCCACCTATCTCCTCTTAAGCTTTGCTCATTTCGTCCTCTTCACCCT[G/A]
GTCCACTTAGAGCAGATACAATAGCAGACTATAAGCCAGCTGCAAACATATTTTAAGAAGATAAATAAAAAAAGAAAAGAGCAGCGGGCTACAGATTTGT
ACAAATCTGTAGCCCGCTGCTCTTTTCTTTTTTTATTTATCTTCTTAAAATATGTTTGCAGCTGGCTTATAGTCTGCTATTGTATCTGCTCTAAGTGGAC[C/T]
AGGGTGAAGAGGACGAAATGAGCAAAGCTTAAGAGGAGATAGGTGGGCTAAGCTCGATCTTAATCTATCTTAAACACTATCATAATTTTGGGCCAGCAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 8.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 3.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400454931 | G -> A | LOC_Os04g01674.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.232; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400454931 | 7.64E-07 | 2.30E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 1.02E-06 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 6.61E-07 | 3.01E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | NA | 1.46E-06 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 2.12E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 1.10E-06 | 2.34E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 6.44E-06 | NA | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 5.11E-06 | 5.11E-06 | mr1670 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 3.15E-07 | NA | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 5.72E-08 | 1.00E-08 | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 7.10E-06 | 2.44E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 1.13E-06 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 4.90E-07 | 1.79E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 3.01E-12 | NA | mr1670_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 1.81E-11 | 1.81E-11 | mr1670_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 2.72E-25 | NA | mr1672_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400454931 | 1.05E-22 | 1.56E-19 | mr1672_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |