\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400445622:

Variant ID: vg0400445622 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 445622
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, C: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ATATCTATAGCAAATATTATTTATATTGAAGTTTGCTCGGGCTCAAAAAAATCATTCTAGCTCCACCACTACACCCCCCTAAAGTGATTTAGGGTATTTG[C/A]
AAGCTTAAATAAGTGGTTTTGAAGAACTAATATAGCATGTTCACGTATTATCAATCATCGATTAATTACCAATTTATATCCTATAGTGATATCATACTAG

Reverse complement sequence

CTAGTATGATATCACTATAGGATATAAATTGGTAATTAATCGATGATTGATAATACGTGAACATGCTATATTAGTTCTTCAAAACCACTTATTTAAGCTT[G/T]
CAAATACCCTAAATCACTTTAGGGGGGTGTAGTGGTGGAGCTAGAATGATTTTTTTGAGCCCGAGCAAACTTCAATATAAATAATATTTGCTATAGATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.00% 27.90% 0.02% 0.00% NA
All Indica  2759 93.20% 6.80% 0.04% 0.00% NA
All Japonica  1512 28.70% 71.30% 0.00% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 89.60% 10.40% 0.00% 0.00% NA
Indica Intermediate  786 92.00% 7.90% 0.13% 0.00% NA
Temperate Japonica  767 36.80% 63.20% 0.00% 0.00% NA
Tropical Japonica  504 23.60% 76.40% 0.00% 0.00% NA
Japonica Intermediate  241 13.70% 86.30% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400445622 C -> A LOC_Os04g01650.1 upstream_gene_variant ; 780.0bp to feature; MODIFIER silent_mutation Average:64.545; most accessible tissue: Zhenshan97 flower, score: 76.961 N N N N
vg0400445622 C -> A LOC_Os04g01660.1 upstream_gene_variant ; 390.0bp to feature; MODIFIER silent_mutation Average:64.545; most accessible tissue: Zhenshan97 flower, score: 76.961 N N N N
vg0400445622 C -> A LOC_Os04g01650-LOC_Os04g01660 intergenic_region ; MODIFIER silent_mutation Average:64.545; most accessible tissue: Zhenshan97 flower, score: 76.961 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400445622 NA 2.06E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400445622 NA 1.90E-06 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400445622 1.00E-12 NA mr1672_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400445622 2.16E-11 1.80E-11 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400445622 NA 6.41E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251