\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400441010:

Variant ID: vg0400441010 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 441010
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, T: 0.24, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AATAGAGAAATGTCAAACATATTTAAAAAATACAACAACGACAGTTTAGATGGAGAAAAAAAAAACAAAGGAATTTGAAAAGAGATAAAAGCTCGAACTA[T/A]
AGTTCCTATGAGGTTGTATCTGTTAAATTTCTTCTCAAACTCCCATGGGTTAAGGCATTGGATAGGATTTAATGGATGTTCAATTCGTTTGTTTCAATGG

Reverse complement sequence

CCATTGAAACAAACGAATTGAACATCCATTAAATCCTATCCAATGCCTTAACCCATGGGAGTTTGAGAAGAAATTTAACAGATACAACCTCATAGGAACT[A/T]
TAGTTCGAGCTTTTATCTCTTTTCAAATTCCTTTGTTTTTTTTTTCTCCATCTAAACTGTCGTTGTTGTATTTTTTAAATATGTTTGACATTTCTCTATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.00% 13.00% 0.02% 0.00% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 64.20% 35.70% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 44.50% 55.50% 0.00% 0.00% NA
Tropical Japonica  504 91.70% 8.10% 0.20% 0.00% NA
Japonica Intermediate  241 69.70% 30.30% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400441010 T -> A LOC_Os04g01650.1 downstream_gene_variant ; 2299.0bp to feature; MODIFIER silent_mutation Average:32.747; most accessible tissue: Callus, score: 79.046 N N N N
vg0400441010 T -> A LOC_Os04g01640-LOC_Os04g01650 intergenic_region ; MODIFIER silent_mutation Average:32.747; most accessible tissue: Callus, score: 79.046 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400441010 NA 4.49E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 2.65E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 1.58E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 7.53E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 1.35E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 7.99E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 5.36E-07 NA mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 2.73E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 7.07E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 2.15E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 2.86E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 2.66E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 4.14E-21 NA mr1672_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 4.51E-17 NA mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 4.79E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 1.60E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 2.65E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400441010 NA 2.67E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251