Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400440847:

Variant ID: vg0400440847 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 440847
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.40, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

GATGATTGGATGTTGATTCGTAGAATTCAATGAATTATATATGATGATGCATGCTTACATAAGTTTTATATGTAATTATTGCTAGTGGATGATGATGTAG[T/C,A]
ATGTTTGCATGTTAAGCTTTAAAATTAGTGGGTTATAACTTTCTAGTAAGATAGGATGAGAAAATAGAGAAATGTCAAACATATTTAAAAAATACAACAA

Reverse complement sequence

TTGTTGTATTTTTTAAATATGTTTGACATTTCTCTATTTTCTCATCCTATCTTACTAGAAAGTTATAACCCACTAATTTTAAAGCTTAACATGCAAACAT[A/G,T]
CTACATCATCATCCACTAGCAATAATTACATATAAAACTTATGTAAGCATGCATCATCATATATAATTCATTGAATTCTACGAATCAACATCCAATCATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.80%	17.00%	0.13%	0.00%	NA
All Indica	2759	95.70%	4.30%	0.07%	0.00%	NA
All Japonica	1512	59.10%	40.80%	0.07%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	91.00%	9.00%	0.00%	0.00%	NA
Indica III	913	97.90%	2.10%	0.00%	0.00%	NA
Indica Intermediate	786	93.50%	6.20%	0.25%	0.00%	NA
Temperate Japonica	767	39.80%	60.20%	0.00%	0.00%	NA
Tropical Japonica	504	84.30%	15.50%	0.20%	0.00%	NA
Japonica Intermediate	241	68.00%	32.00%	0.00%	0.00%	NA
VI/Aromatic	96	52.10%	46.90%	1.04%	0.00%	NA
Intermediate	90	76.70%	21.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400440847	T -> C	LOC_Os04g01650.1	downstream_gene_variant ; 2462.0bp to feature; MODIFIER	silent_mutation	Average:27.453; most accessible tissue: Callus, score: 45.498	N	N	N	N
vg0400440847	T -> C	LOC_Os04g01640-LOC_Os04g01650	intergenic_region ; MODIFIER	silent_mutation	Average:27.453; most accessible tissue: Callus, score: 45.498	N	N	N	N
vg0400440847	T -> A	LOC_Os04g01650.1	downstream_gene_variant ; 2462.0bp to feature; MODIFIER	N	Average:27.453; most accessible tissue: Callus, score: 45.498	N	N	N	N
vg0400440847	T -> A	LOC_Os04g01640-LOC_Os04g01650	intergenic_region ; MODIFIER	N	Average:27.453; most accessible tissue: Callus, score: 45.498	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400440847	NA	3.37E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400440847	1.85E-06	NA	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400440847	NA	7.58E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400440847	1.46E-15	NA	mr1672_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400440847	1.82E-16	NA	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251