\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400439184:

Variant ID: vg0400439184 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 439184
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACATGAGTACGTGAGTGTAGGCATTCGTCTTTCATATAATAATCATAATAAAACACAAAAATAATGAATAATTGAATCTATAGATGTCCTTCATGCAT[C/T]
CAGAAATGCACGTAGTAGTAGCAGTACTAGTAGTGCTAACTACATTCAAATGCACGGTTTCACGATCTGAATTATGCAATGGTCGTAGCCGGCAAACTGG

Reverse complement sequence

CCAGTTTGCCGGCTACGACCATTGCATAATTCAGATCGTGAAACCGTGCATTTGAATGTAGTTAGCACTACTAGTACTGCTACTACTACGTGCATTTCTG[G/A]
ATGCATGAAGGACATCTATAGATTCAATTATTCATTATTTTTGTGTTTTATTATGATTATTATATGAAAGACGAATGCCTACACTCACGTACTCATGTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.50% 3.20% 0.23% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 89.40% 9.90% 0.73% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 79.40% 19.20% 1.43% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400439184 C -> T LOC_Os04g01650.1 downstream_gene_variant ; 4125.0bp to feature; MODIFIER silent_mutation Average:71.23; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg0400439184 C -> T LOC_Os04g01640-LOC_Os04g01650 intergenic_region ; MODIFIER silent_mutation Average:71.23; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400439184 4.62E-08 8.56E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400439184 6.02E-07 2.65E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400439184 2.68E-06 2.64E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400439184 1.51E-08 1.65E-11 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400439184 5.76E-07 8.12E-08 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400439184 1.75E-08 3.42E-11 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400439184 NA 9.37E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400439184 6.59E-08 1.78E-12 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400439184 2.89E-11 2.89E-11 mr1670_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400439184 9.98E-16 4.22E-14 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400439184 1.29E-06 1.61E-08 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251