\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400436102:

Variant ID: vg0400436102 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 436102
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCCCGCCCTCCCCCTCCTGCTGTGCACATGGGAAGGGATAAGAAAGAAAAGAGATAAGGAGGAAGGGAAGAAGGGAAGAGATAAGGATTAGAGATGGAG[A/G]
GAGGAGTTTGTGTGGACGGAAAAAGAGGATAAGTAATAGGGATTATATAGTGCGTTTTGATCTTTAATCCCGGTTAGTAACACAAACCGGGACTCCCAGT

Reverse complement sequence

ACTGGGAGTCCCGGTTTGTGTTACTAACCGGGATTAAAGATCAAAACGCACTATATAATCCCTATTACTTATCCTCTTTTTCCGTCCACACAAACTCCTC[T/C]
CTCCATCTCTAATCCTTATCTCTTCCCTTCTTCCCTTCCTCCTTATCTCTTTTCTTTCTTATCCCTTCCCATGTGCACAGCAGGAGGGGGAGGGCGGGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 6.50% 0.00% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 83.00% 17.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 68.40% 31.60% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400436102 A -> G LOC_Os04g01640.1 downstream_gene_variant ; 2101.0bp to feature; MODIFIER silent_mutation Average:46.542; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0400436102 A -> G LOC_Os04g01640-LOC_Os04g01650 intergenic_region ; MODIFIER silent_mutation Average:46.542; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400436102 NA 5.70E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 5.14E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 NA 2.11E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 3.13E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 NA 5.47E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 NA 1.50E-06 mr1492 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 3.89E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 NA 4.90E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 1.32E-09 NA mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 2.06E-06 2.06E-06 mr1670 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 NA 8.36E-06 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 NA 2.11E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 NA 7.35E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 NA 6.60E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 1.93E-06 NA mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 3.31E-06 2.78E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 NA 7.39E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 4.00E-19 NA mr1670_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 4.39E-11 4.39E-11 mr1670_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 9.36E-13 NA mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400436102 8.05E-12 1.35E-11 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251