Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400435492:

Variant ID: vg0400435492 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 435492
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.52, C: 0.48, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGCCCCCAAGTTGTGGACCTTGTGGTACCACTGGTGGAGAAATCGTTTTTAAGTCCCGGTTCGTAATCTCTATAGTTTCGGTTTTTAAACCGGGACTA[T/C]
GAATCCGGGACTAAAGATCCTTATCTTTAGTTCCGGTTTAAATACTCGGAACTGAAGATCGATCTTTAGTCCTGGTTGGTGTTACCAATCGGGACTAAAG

Reverse complement sequence

CTTTAGTCCCGATTGGTAACACCAACCAGGACTAAAGATCGATCTTCAGTTCCGAGTATTTAAACCGGAACTAAAGATAAGGATCTTTAGTCCCGGATTC[A/G]
TAGTCCCGGTTTAAAAACCGAAACTATAGAGATTACGAACCGGGACTTAAAAACGATTTCTCCACCAGTGGTACCACAAGGTCCACAACTTGGGGGCTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 32.40% 0.17% 0.00% NA
All Indica  2759 96.00% 4.00% 0.04% 0.00% NA
All Japonica  1512 11.30% 88.40% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 96.40% 3.60% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 6.60% 0.13% 0.00% NA
Temperate Japonica  767 4.60% 95.20% 0.26% 0.00% NA
Tropical Japonica  504 24.40% 75.40% 0.20% 0.00% NA
Japonica Intermediate  241 5.40% 94.20% 0.41% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 60.00% 36.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400435492 T -> C LOC_Os04g01640.1 downstream_gene_variant ; 1491.0bp to feature; MODIFIER silent_mutation Average:49.464; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0400435492 T -> C LOC_Os04g01640-LOC_Os04g01650 intergenic_region ; MODIFIER silent_mutation Average:49.464; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400435492 NA 1.55E-12 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 4.05E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 3.86E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 5.35E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 7.74E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 5.39E-16 mr1035_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 2.06E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 2.99E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 9.66E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 5.05E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 1.01E-37 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 3.28E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 2.96E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 4.19E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 7.92E-32 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 4.85E-20 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 3.10E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 2.49E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 3.40E-09 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 2.71E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 9.22E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400435492 NA 2.21E-37 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251