\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400416361:

Variant ID: vg0400416361 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 416361
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGCCAAAATTTGGCAATTTTGAACAAAAATTATTCTCCAACATACTTGCTATTTCAATGGCCAAGCCATCCAGCTAGCTAAACTGCCTCCCTCGCTGG[C/A]
CAAATTTGGCCAGCTAAAACCGGCTAGCCATCCATGGGACCCACGCCTGTTTCCCATCTCTCTCCACGCACACCCTCCATCCGAGCACATGCAGTGGCGG

Reverse complement sequence

CCGCCACTGCATGTGCTCGGATGGAGGGTGTGCGTGGAGAGAGATGGGAAACAGGCGTGGGTCCCATGGATGGCTAGCCGGTTTTAGCTGGCCAAATTTG[G/T]
CCAGCGAGGGAGGCAGTTTAGCTAGCTGGATGGCTTGGCCATTGAAATAGCAAGTATGTTGGAGAATAATTTTTGTTCAAAATTGCCAAATTTTGGCTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 4.70% 0.00% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 85.60% 14.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 72.20% 27.80% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400416361 C -> A LOC_Os04g01610.1 upstream_gene_variant ; 3977.0bp to feature; MODIFIER silent_mutation Average:67.831; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N
vg0400416361 C -> A LOC_Os04g01620.1 upstream_gene_variant ; 2373.0bp to feature; MODIFIER silent_mutation Average:67.831; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N
vg0400416361 C -> A LOC_Os04g01610-LOC_Os04g01620 intergenic_region ; MODIFIER silent_mutation Average:67.831; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400416361 9.18E-08 1.55E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 3.13E-07 1.03E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 NA 8.81E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 1.44E-07 1.70E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 3.54E-07 3.54E-07 mr1670 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 1.63E-07 1.53E-08 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 NA 5.11E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 8.34E-07 1.07E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 6.18E-08 2.31E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 7.78E-14 7.78E-14 mr1670_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 3.07E-21 1.68E-19 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400416361 5.34E-06 2.35E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251