Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0400401937:

Variant ID: vg0400401937 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 401937
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAAGCTATATGTTTAGTATCAATTTATCCCAAAACTATGACGTTTATAACTCCAACATAATGTTAGTACTAGGGATTAAACTCTAGAATATGTATTTT[C/T]
GTGATAACTTCAATATTAAATCTATAGTTTTGTGATAAATTTAATATAAAATCTGTAGTTTTATGATACTCGGCTTTAAATGTGTAGTTTTGGGATAAAT

Reverse complement sequence

ATTTATCCCAAAACTACACATTTAAAGCCGAGTATCATAAAACTACAGATTTTATATTAAATTTATCACAAAACTATAGATTTAATATTGAAGTTATCAC[G/A]
AAAATACATATTCTAGAGTTTAATCCCTAGTACTAACATTATGTTGGAGTTATAAACGTCATAGTTTTGGGATAAATTGATACTAAACATATAGCTTTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.50%	22.20%	0.23%	0.00%	NA
All Indica	2759	62.90%	36.80%	0.33%	0.00%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	90.10%	9.70%	0.17%	0.00%	NA
Indica II	465	33.80%	66.00%	0.22%	0.00%	NA
Indica III	913	65.10%	34.60%	0.33%	0.00%	NA
Indica Intermediate	786	57.10%	42.40%	0.51%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400401937	C -> T	LOC_Os04g01590.1	downstream_gene_variant ; 990.0bp to feature; MODIFIER	silent_mutation	Average:41.045; most accessible tissue: Callus, score: 79.163	N	N	N	N
vg0400401937	C -> T	LOC_Os04g01600.1	intron_variant ; MODIFIER	silent_mutation	Average:41.045; most accessible tissue: Callus, score: 79.163	N	N	N	N
vg0400401937	C -> T	LOC_Os04g01600.2	intron_variant ; MODIFIER	silent_mutation	Average:41.045; most accessible tissue: Callus, score: 79.163	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400401937	NA	6.58E-15	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400401937	5.50E-06	9.78E-14	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400401937	NA	4.80E-06	mr1919	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400401937	NA	2.34E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400401937	NA	4.15E-16	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400401937	6.83E-07	1.79E-15	mr1565_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400401937	NA	6.70E-10	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251