Variant ID: vg0400401937 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 401937 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 117. )
ACAAAGCTATATGTTTAGTATCAATTTATCCCAAAACTATGACGTTTATAACTCCAACATAATGTTAGTACTAGGGATTAAACTCTAGAATATGTATTTT[C/T]
GTGATAACTTCAATATTAAATCTATAGTTTTGTGATAAATTTAATATAAAATCTGTAGTTTTATGATACTCGGCTTTAAATGTGTAGTTTTGGGATAAAT
ATTTATCCCAAAACTACACATTTAAAGCCGAGTATCATAAAACTACAGATTTTATATTAAATTTATCACAAAACTATAGATTTAATATTGAAGTTATCAC[G/A]
AAAATACATATTCTAGAGTTTAATCCCTAGTACTAACATTATGTTGGAGTTATAAACGTCATAGTTTTGGGATAAATTGATACTAAACATATAGCTTTGT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 77.50% | 22.20% | 0.23% | 0.00% | NA |
All Indica | 2759 | 62.90% | 36.80% | 0.33% | 0.00% | NA |
All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 90.10% | 9.70% | 0.17% | 0.00% | NA |
Indica II | 465 | 33.80% | 66.00% | 0.22% | 0.00% | NA |
Indica III | 913 | 65.10% | 34.60% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 57.10% | 42.40% | 0.51% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0400401937 | C -> T | LOC_Os04g01590.1 | downstream_gene_variant ; 990.0bp to feature; MODIFIER | silent_mutation | Average:41.045; most accessible tissue: Callus, score: 79.163 | N | N | N | N |
vg0400401937 | C -> T | LOC_Os04g01600.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.045; most accessible tissue: Callus, score: 79.163 | N | N | N | N |
vg0400401937 | C -> T | LOC_Os04g01600.2 | intron_variant ; MODIFIER | silent_mutation | Average:41.045; most accessible tissue: Callus, score: 79.163 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0400401937 | NA | 6.58E-15 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0400401937 | 5.50E-06 | 9.78E-14 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0400401937 | NA | 4.80E-06 | mr1919 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0400401937 | NA | 2.34E-06 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0400401937 | NA | 4.15E-16 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0400401937 | 6.83E-07 | 1.79E-15 | mr1565_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0400401937 | NA | 6.70E-10 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |