\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400380170:

Variant ID: vg0400380170 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 380170
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTATTTTATTCCGATTCTAGTTATTTTCAAATTGTATTCATATGTGGACTTTAGACTTGTTTTGTACTATTTCTTATTTTTCCAATTTTGAATTTTT[A/G]
CTTCTTCTAAGTTGTATTTCTATATGGACTCTAGACTTATCTTTCAATATTCCTTATTATAAATTTCGAATTTTAGTTTTTTCTAAGTTGTTTTTCTATA

Reverse complement sequence

TATAGAAAAACAACTTAGAAAAAACTAAAATTCGAAATTTATAATAAGGAATATTGAAAGATAAGTCTAGAGTCCATATAGAAATACAACTTAGAAGAAG[T/C]
AAAAATTCAAAATTGGAAAAATAAGAAATAGTACAAAACAAGTCTAAAGTCCACATATGAATACAATTTGAAAATAACTAGAATCGGAATAAAATAAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 6.70% 0.17% 5.97% NA
All Indica  2759 96.40% 2.30% 0.00% 1.23% NA
All Japonica  1512 86.30% 13.40% 0.20% 0.13% NA
Aus  269 15.20% 0.40% 1.49% 82.90% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 98.90% 0.60% 0.00% 0.43% NA
Indica III  913 93.60% 4.20% 0.00% 2.19% NA
Indica Intermediate  786 96.40% 2.00% 0.00% 1.53% NA
Temperate Japonica  767 78.20% 21.60% 0.13% 0.00% NA
Tropical Japonica  504 94.20% 5.60% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 3.30% 0.41% 0.83% NA
VI/Aromatic  96 35.40% 45.80% 1.04% 17.71% NA
Intermediate  90 85.60% 7.80% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400380170 A -> DEL N N silent_mutation Average:23.493; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0400380170 A -> G LOC_Os04g01550.1 upstream_gene_variant ; 3752.0bp to feature; MODIFIER silent_mutation Average:23.493; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0400380170 A -> G LOC_Os04g01560.1 upstream_gene_variant ; 1777.0bp to feature; MODIFIER silent_mutation Average:23.493; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0400380170 A -> G LOC_Os04g01550-LOC_Os04g01560 intergenic_region ; MODIFIER silent_mutation Average:23.493; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400380170 2.44E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 NA 5.09E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 3.33E-07 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 NA 1.76E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 NA 1.50E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 3.90E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 NA 7.31E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 2.59E-07 3.38E-08 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 3.44E-09 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 4.56E-07 2.79E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 8.13E-06 NA mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 1.64E-06 7.87E-10 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 NA 1.50E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 7.37E-08 NA mr1670_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 7.64E-06 7.64E-06 mr1670_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 1.54E-06 NA mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 1.29E-08 2.61E-08 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400380170 NA 8.88E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251