\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400377457:

Variant ID: vg0400377457 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 377457
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTCTTCAACCTGTTGAGGTGCTTGTCTAGGAAAATCATTTTTTACTAGTGATATGACATCAAAGTGTGTTTTGATTATTATTTTGTGATAAATAATTA[A/G]
CTTGTGAGATAATTGATTTTTATATTTGATGATTATTGGCGATGTGGTGCTAGCTAATTGTGTGGGACCGGTCAGACCGGGTGGAGTAGGTCGATCAGAC

Reverse complement sequence

GTCTGATCGACCTACTCCACCCGGTCTGACCGGTCCCACACAATTAGCTAGCACCACATCGCCAATAATCATCAAATATAAAAATCAATTATCTCACAAG[T/C]
TAATTATTTATCACAAAATAATAATCAAAACACACTTTGATGTCATATCACTAGTAAAAAATGATTTTCCTAGACAAGCACCTCAACAGGTTGAAGACGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 6.00% 1.04% 26.43% NA
All Indica  2759 64.10% 0.80% 1.30% 33.82% NA
All Japonica  1512 83.70% 13.80% 0.13% 2.31% NA
Aus  269 3.70% 0.40% 3.35% 92.57% NA
Indica I  595 31.40% 1.20% 2.69% 64.71% NA
Indica II  465 78.90% 0.60% 0.86% 19.57% NA
Indica III  913 68.30% 0.30% 1.10% 30.23% NA
Indica Intermediate  786 75.10% 1.10% 0.76% 23.03% NA
Temperate Japonica  767 77.80% 22.20% 0.00% 0.00% NA
Tropical Japonica  504 87.30% 5.80% 0.40% 6.55% NA
Japonica Intermediate  241 95.00% 4.10% 0.00% 0.83% NA
VI/Aromatic  96 34.40% 46.90% 0.00% 18.75% NA
Intermediate  90 75.60% 6.70% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400377457 A -> DEL N N silent_mutation Average:14.771; most accessible tissue: Callus, score: 75.999 N N N N
vg0400377457 A -> G LOC_Os04g01550.1 upstream_gene_variant ; 1039.0bp to feature; MODIFIER silent_mutation Average:14.771; most accessible tissue: Callus, score: 75.999 N N N N
vg0400377457 A -> G LOC_Os04g01560.1 upstream_gene_variant ; 4490.0bp to feature; MODIFIER silent_mutation Average:14.771; most accessible tissue: Callus, score: 75.999 N N N N
vg0400377457 A -> G LOC_Os04g01550-LOC_Os04g01560 intergenic_region ; MODIFIER silent_mutation Average:14.771; most accessible tissue: Callus, score: 75.999 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400377457 2.24E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 NA 1.10E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 1.70E-07 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 NA 1.71E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 NA 4.15E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 8.14E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 NA 1.29E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 1.33E-07 2.73E-08 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 NA 9.93E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 7.84E-09 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 1.59E-06 1.85E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 1.38E-06 5.62E-10 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 NA 1.77E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 6.11E-07 NA mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 4.78E-08 NA mr1672_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 8.25E-09 3.31E-08 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400377457 NA 3.82E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251