Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400373812:

Variant ID: vg0400373812 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 373812
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CCACATCTAATGCCACACACACACACACACCAAGAGTGGCAAACTTGTCTTTCCTGCTTGAGTTGTTGCCAGTGACGAATCTAGATGAAAATATAGGTGG[G/A]
GCTTTATTTATCGTCATAATATAAAATAATAATCATATATCTTTAATCTATATCAACAATATTTGAAAATCCTACACGGATAGAAAAACGGTGGATTAAA

Reverse complement sequence

TTTAATCCACCGTTTTTCTATCCGTGTAGGATTTTCAAATATTGTTGATATAGATTAAAGATATATGATTATTATTTTATATTATGACGATAAATAAAGC[C/T]
CCACCTATATTTTCATCTAGATTCGTCACTGGCAACAACTCAAGCAGGAAAGACAAGTTTGCCACTCTTGGTGTGTGTGTGTGTGTGGCATTAGATGTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 44.10% 0.61% 6.24% NA
All Indica  2759 49.40% 48.40% 0.94% 1.27% NA
All Japonica  1512 54.90% 44.90% 0.07% 0.13% NA
Aus  269 1.50% 10.80% 0.74% 86.99% NA
Indica I  595 25.40% 74.50% 0.17% 0.00% NA
Indica II  465 70.80% 28.00% 0.86% 0.43% NA
Indica III  913 48.10% 47.90% 1.86% 2.19% NA
Indica Intermediate  786 56.60% 41.20% 0.51% 1.65% NA
Temperate Japonica  767 88.50% 11.50% 0.00% 0.00% NA
Tropical Japonica  504 12.90% 86.90% 0.20% 0.00% NA
Japonica Intermediate  241 35.70% 63.50% 0.00% 0.83% NA
VI/Aromatic  96 69.80% 12.50% 0.00% 17.71% NA
Intermediate  90 61.10% 31.10% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400373812 G -> DEL N N silent_mutation Average:80.006; most accessible tissue: Minghui63 root, score: 96.11 N N N N
vg0400373812 G -> A LOC_Os04g01540.1 upstream_gene_variant ; 1391.0bp to feature; MODIFIER silent_mutation Average:80.006; most accessible tissue: Minghui63 root, score: 96.11 N N N N
vg0400373812 G -> A LOC_Os04g01550.1 downstream_gene_variant ; 1598.0bp to feature; MODIFIER silent_mutation Average:80.006; most accessible tissue: Minghui63 root, score: 96.11 N N N N
vg0400373812 G -> A LOC_Os04g01540-LOC_Os04g01550 intergenic_region ; MODIFIER silent_mutation Average:80.006; most accessible tissue: Minghui63 root, score: 96.11 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0400373812 G A -0.1 -0.11 -0.08 -0.03 -0.08 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400373812 NA 1.65E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 3.28E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 3.22E-10 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 2.66E-06 4.33E-13 mr1565 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 1.36E-12 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 2.35E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 4.35E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 6.25E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 4.55E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 2.55E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 5.60E-06 mr1127_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 2.09E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 2.66E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 2.28E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 9.29E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 7.41E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 1.70E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 2.01E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 1.71E-08 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 1.85E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 1.02E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 7.87E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 3.15E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 2.76E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 3.26E-09 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 2.82E-07 4.74E-17 mr1565_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 5.93E-07 2.76E-14 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 6.68E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 1.14E-08 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 1.02E-09 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 4.40E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 2.04E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 2.33E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400373812 NA 5.87E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251