Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400372962:

Variant ID: vg0400372962 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 372962
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCCGGATTACATAGTTAGGGGTGAAGAATGTCCGGTTTTATGGTTCAGGGGGGTAATTCAGACGACCGCGATAGTTCGGGGGAGGGGGTAATTCGTA[C/A]
TTCTTCCAAAAAAAATATGATTTTTTTACTAAAATATGTACAAAATAATTTTATGTTTTTTACAACGTCCCAAGCCCGGAATAATTAACAATTTGTCATT

Reverse complement sequence

AATGACAAATTGTTAATTATTCCGGGCTTGGGACGTTGTAAAAAACATAAAATTATTTTGTACATATTTTAGTAAAAAAATCATATTTTTTTTGGAAGAA[G/T]
TACGAATTACCCCCTCCCCCGAACTATCGCGGTCGTCTGAATTACCCCCCTGAACCATAAAACCGGACATTCTTCACCCCTAACTATGTAATCCGGACGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 45.70% 8.13% 0.25% NA
All Indica  2759 44.70% 45.60% 9.60% 0.07% NA
All Japonica  1512 40.30% 53.10% 5.95% 0.60% NA
Aus  269 98.10% 1.50% 0.37% 0.00% NA
Indica I  595 72.40% 15.00% 12.61% 0.00% NA
Indica II  465 24.90% 71.60% 3.44% 0.00% NA
Indica III  913 42.30% 47.50% 10.19% 0.00% NA
Indica Intermediate  786 38.30% 51.10% 10.31% 0.25% NA
Temperate Japonica  767 11.10% 77.80% 10.82% 0.26% NA
Tropical Japonica  504 75.20% 23.60% 0.60% 0.60% NA
Japonica Intermediate  241 60.60% 36.10% 1.66% 1.66% NA
VI/Aromatic  96 30.20% 47.90% 21.88% 0.00% NA
Intermediate  90 35.60% 55.60% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400372962 C -> DEL N N silent_mutation Average:84.337; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg0400372962 C -> A LOC_Os04g01540.1 upstream_gene_variant ; 541.0bp to feature; MODIFIER silent_mutation Average:84.337; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg0400372962 C -> A LOC_Os04g01550.1 downstream_gene_variant ; 2448.0bp to feature; MODIFIER silent_mutation Average:84.337; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg0400372962 C -> A LOC_Os04g01540-LOC_Os04g01550 intergenic_region ; MODIFIER silent_mutation Average:84.337; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0400372962 C A -0.02 0.01 0.02 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400372962 NA 7.86E-11 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 5.10E-06 6.10E-13 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 4.84E-06 4.96E-13 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 4.23E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 1.46E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 1.82E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 2.82E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 7.27E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 9.07E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 3.84E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 2.86E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 1.13E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 5.96E-08 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 4.93E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 2.53E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 1.09E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 3.75E-10 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 9.30E-07 3.11E-17 mr1565_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 1.31E-06 5.83E-15 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 3.38E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 1.42E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 8.33E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 1.26E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 5.13E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 5.13E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400372962 NA 2.06E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251