\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400368893:

Variant ID: vg0400368893 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 368893
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGATCATGTTATTGGGCCACGTCAACGAAAACCACCGACCAATATTGCTGAGGGAGTTAATTTACAACACTCTTGTGAGTTAGAGGACAGATTATACC[T/C]
AGTTTTGCGATTGAAGGATGCGATTCAACCAGGGGCGTGAGGTGAGGGAGGCAAAGTAGACATTCCTTTTGCAGTCGAGGTGGTTCTAGCTGATGACAAA

Reverse complement sequence

TTTGTCATCAGCTAGAACCACCTCGACTGCAAAAGGAATGTCTACTTTGCCTCCCTCACCTCACGCCCCTGGTTGAATCGCATCCTTCAATCGCAAAACT[A/G]
GGTATAATCTGTCCTCTAACTCACAAGAGTGTTGTAAATTAACTCCCTCAGCAATATTGGTCGGTGGTTTTCGTTGACGTGGCCCAATAACATGATCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 14.70% 0.38% 20.61% NA
All Indica  2759 63.90% 1.30% 0.47% 34.32% NA
All Japonica  1512 57.50% 42.20% 0.26% 0.00% NA
Aus  269 92.90% 0.40% 0.00% 6.69% NA
Indica I  595 29.10% 0.70% 0.50% 69.75% NA
Indica II  465 78.30% 1.70% 0.43% 19.57% NA
Indica III  913 69.60% 1.80% 0.44% 28.26% NA
Indica Intermediate  786 75.10% 1.10% 0.51% 23.28% NA
Temperate Japonica  767 34.60% 64.90% 0.52% 0.00% NA
Tropical Japonica  504 87.10% 12.90% 0.00% 0.00% NA
Japonica Intermediate  241 68.90% 31.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 70.00% 20.00% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400368893 T -> C LOC_Os04g01530.2 upstream_gene_variant ; 1445.0bp to feature; MODIFIER silent_mutation Average:14.823; most accessible tissue: Callus, score: 92.528 N N N N
vg0400368893 T -> C LOC_Os04g01530.1 upstream_gene_variant ; 1445.0bp to feature; MODIFIER silent_mutation Average:14.823; most accessible tissue: Callus, score: 92.528 N N N N
vg0400368893 T -> C LOC_Os04g01540.1 downstream_gene_variant ; 1877.0bp to feature; MODIFIER silent_mutation Average:14.823; most accessible tissue: Callus, score: 92.528 N N N N
vg0400368893 T -> C LOC_Os04g01530-LOC_Os04g01540 intergenic_region ; MODIFIER silent_mutation Average:14.823; most accessible tissue: Callus, score: 92.528 N N N N
vg0400368893 T -> DEL N N silent_mutation Average:14.823; most accessible tissue: Callus, score: 92.528 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400368893 NA 4.71E-18 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400368893 NA 2.78E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400368893 NA 4.72E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400368893 NA 3.39E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400368893 1.07E-08 2.53E-33 mr1768_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400368893 NA 1.92E-07 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251