\
| Variant ID: vg0400368893 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 368893 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 113. )
GTTGATCATGTTATTGGGCCACGTCAACGAAAACCACCGACCAATATTGCTGAGGGAGTTAATTTACAACACTCTTGTGAGTTAGAGGACAGATTATACC[T/C]
AGTTTTGCGATTGAAGGATGCGATTCAACCAGGGGCGTGAGGTGAGGGAGGCAAAGTAGACATTCCTTTTGCAGTCGAGGTGGTTCTAGCTGATGACAAA
TTTGTCATCAGCTAGAACCACCTCGACTGCAAAAGGAATGTCTACTTTGCCTCCCTCACCTCACGCCCCTGGTTGAATCGCATCCTTCAATCGCAAAACT[A/G]
GGTATAATCTGTCCTCTAACTCACAAGAGTGTTGTAAATTAACTCCCTCAGCAATATTGGTCGGTGGTTTTCGTTGACGTGGCCCAATAACATGATCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.30% | 14.70% | 0.38% | 20.61% | NA |
| All Indica | 2759 | 63.90% | 1.30% | 0.47% | 34.32% | NA |
| All Japonica | 1512 | 57.50% | 42.20% | 0.26% | 0.00% | NA |
| Aus | 269 | 92.90% | 0.40% | 0.00% | 6.69% | NA |
| Indica I | 595 | 29.10% | 0.70% | 0.50% | 69.75% | NA |
| Indica II | 465 | 78.30% | 1.70% | 0.43% | 19.57% | NA |
| Indica III | 913 | 69.60% | 1.80% | 0.44% | 28.26% | NA |
| Indica Intermediate | 786 | 75.10% | 1.10% | 0.51% | 23.28% | NA |
| Temperate Japonica | 767 | 34.60% | 64.90% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 70.00% | 20.00% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400368893 | T -> C | LOC_Os04g01530.2 | upstream_gene_variant ; 1445.0bp to feature; MODIFIER | silent_mutation | Average:14.823; most accessible tissue: Callus, score: 92.528 | N | N | N | N |
| vg0400368893 | T -> C | LOC_Os04g01530.1 | upstream_gene_variant ; 1445.0bp to feature; MODIFIER | silent_mutation | Average:14.823; most accessible tissue: Callus, score: 92.528 | N | N | N | N |
| vg0400368893 | T -> C | LOC_Os04g01540.1 | downstream_gene_variant ; 1877.0bp to feature; MODIFIER | silent_mutation | Average:14.823; most accessible tissue: Callus, score: 92.528 | N | N | N | N |
| vg0400368893 | T -> C | LOC_Os04g01530-LOC_Os04g01540 | intergenic_region ; MODIFIER | silent_mutation | Average:14.823; most accessible tissue: Callus, score: 92.528 | N | N | N | N |
| vg0400368893 | T -> DEL | N | N | silent_mutation | Average:14.823; most accessible tissue: Callus, score: 92.528 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400368893 | NA | 4.71E-18 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400368893 | NA | 2.78E-08 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400368893 | NA | 4.72E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400368893 | NA | 3.39E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400368893 | 1.07E-08 | 2.53E-33 | mr1768_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400368893 | NA | 1.92E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |