Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0400368893:

Variant ID: vg0400368893 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 368893
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGATCATGTTATTGGGCCACGTCAACGAAAACCACCGACCAATATTGCTGAGGGAGTTAATTTACAACACTCTTGTGAGTTAGAGGACAGATTATACC[T/C]
AGTTTTGCGATTGAAGGATGCGATTCAACCAGGGGCGTGAGGTGAGGGAGGCAAAGTAGACATTCCTTTTGCAGTCGAGGTGGTTCTAGCTGATGACAAA

Reverse complement sequence

TTTGTCATCAGCTAGAACCACCTCGACTGCAAAAGGAATGTCTACTTTGCCTCCCTCACCTCACGCCCCTGGTTGAATCGCATCCTTCAATCGCAAAACT[A/G]
GGTATAATCTGTCCTCTAACTCACAAGAGTGTTGTAAATTAACTCCCTCAGCAATATTGGTCGGTGGTTTTCGTTGACGTGGCCCAATAACATGATCAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	14.70%	0.38%	20.61%	NA
All Indica	2759	63.90%	1.30%	0.47%	34.32%	NA
All Japonica	1512	57.50%	42.20%	0.26%	0.00%	NA
Aus	269	92.90%	0.40%	0.00%	6.69%	NA
Indica I	595	29.10%	0.70%	0.50%	69.75%	NA
Indica II	465	78.30%	1.70%	0.43%	19.57%	NA
Indica III	913	69.60%	1.80%	0.44%	28.26%	NA
Indica Intermediate	786	75.10%	1.10%	0.51%	23.28%	NA
Temperate Japonica	767	34.60%	64.90%	0.52%	0.00%	NA
Tropical Japonica	504	87.10%	12.90%	0.00%	0.00%	NA
Japonica Intermediate	241	68.90%	31.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	70.00%	20.00%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400368893	T -> C	LOC_Os04g01530.2	upstream_gene_variant ; 1445.0bp to feature; MODIFIER	silent_mutation	Average:14.823; most accessible tissue: Callus, score: 92.528	N	N	N	N
vg0400368893	T -> C	LOC_Os04g01530.1	upstream_gene_variant ; 1445.0bp to feature; MODIFIER	silent_mutation	Average:14.823; most accessible tissue: Callus, score: 92.528	N	N	N	N
vg0400368893	T -> C	LOC_Os04g01540.1	downstream_gene_variant ; 1877.0bp to feature; MODIFIER	silent_mutation	Average:14.823; most accessible tissue: Callus, score: 92.528	N	N	N	N
vg0400368893	T -> C	LOC_Os04g01530-LOC_Os04g01540	intergenic_region ; MODIFIER	silent_mutation	Average:14.823; most accessible tissue: Callus, score: 92.528	N	N	N	N
vg0400368893	T -> DEL	N	N	silent_mutation	Average:14.823; most accessible tissue: Callus, score: 92.528	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400368893	NA	4.71E-18	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400368893	NA	2.78E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400368893	NA	4.72E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400368893	NA	3.39E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400368893	1.07E-08	2.53E-33	mr1768_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400368893	NA	1.92E-07	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251