\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400357479:

Variant ID: vg0400357479 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 357479
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCCATCAGATTTGAGGTTTTCTTATTAAAGAAGAATTTGGTTTTTGGCGTTTATATCATTTACTCTTCTTCTATGGTAGGTTTGGTTTCTTATATCC[G/A]
CTTCAACGTCATGCTCTGCCCATCGGCATTCGAACTCCTATCTGCCCAAGCTACACCGGGGATCATAATCATGTCCTACAATGAAGAGTTAAATGAACAA

Reverse complement sequence

TTGTTCATTTAACTCTTCATTGTAGGACATGATTATGATCCCCGGTGTAGCTTGGGCAGATAGGAGTTCGAATGCCGATGGGCAGAGCATGACGTTGAAG[C/T]
GGATATAAGAAACCAAACCTACCATAGAAGAAGAGTAAATGATATAAACGCCAAAAACCAAATTCTTCTTTAATAAGAAAACCTCAAATCTGATGGAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 4.20% 0.21% 0.00% NA
All Indica  2759 99.10% 0.90% 0.04% 0.00% NA
All Japonica  1512 91.10% 8.30% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 83.30% 15.50% 1.17% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400357479 G -> A LOC_Os04g01510.1 downstream_gene_variant ; 2016.0bp to feature; MODIFIER silent_mutation Average:72.918; most accessible tissue: Zhenshan97 flower, score: 87.848 N N N N
vg0400357479 G -> A LOC_Os04g01520.1 downstream_gene_variant ; 112.0bp to feature; MODIFIER silent_mutation Average:72.918; most accessible tissue: Zhenshan97 flower, score: 87.848 N N N N
vg0400357479 G -> A LOC_Os04g01510.2 downstream_gene_variant ; 2016.0bp to feature; MODIFIER silent_mutation Average:72.918; most accessible tissue: Zhenshan97 flower, score: 87.848 N N N N
vg0400357479 G -> A LOC_Os04g01510-LOC_Os04g01520 intergenic_region ; MODIFIER silent_mutation Average:72.918; most accessible tissue: Zhenshan97 flower, score: 87.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400357479 2.64E-07 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 NA 7.39E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 4.80E-08 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 NA 2.27E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 NA 1.66E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 NA 1.16E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 1.03E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 NA 2.53E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 1.40E-06 NA mr1672 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 4.57E-06 7.92E-07 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 NA 8.91E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 2.16E-11 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 3.46E-08 3.56E-11 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 2.57E-06 NA mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 NA 1.00E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 5.75E-06 1.18E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 2.64E-08 6.75E-14 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 5.19E-06 1.01E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 NA 3.65E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 1.72E-07 1.73E-07 mr1703_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 2.11E-07 NA mr1765_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 6.27E-06 2.58E-08 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479 7.90E-07 NA mr1793_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251