Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400357479:

Variant ID: vg0400357479 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 357479
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AACTCCATCAGATTTGAGGTTTTCTTATTAAAGAAGAATTTGGTTTTTGGCGTTTATATCATTTACTCTTCTTCTATGGTAGGTTTGGTTTCTTATATCC[G/A]
CTTCAACGTCATGCTCTGCCCATCGGCATTCGAACTCCTATCTGCCCAAGCTACACCGGGGATCATAATCATGTCCTACAATGAAGAGTTAAATGAACAA

Reverse complement sequence

TTGTTCATTTAACTCTTCATTGTAGGACATGATTATGATCCCCGGTGTAGCTTGGGCAGATAGGAGTTCGAATGCCGATGGGCAGAGCATGACGTTGAAG[C/T]
GGATATAAGAAACCAAACCTACCATAGAAGAAGAGTAAATGATATAAACGCCAAAAACCAAATTCTTCTTTAATAAGAAAACCTCAAATCTGATGGAGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	4.20%	0.21%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.04%	0.00%	NA
All Japonica	1512	91.10%	8.30%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	98.40%	1.60%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	83.30%	15.50%	1.17%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	54.20%	45.80%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400357479	G -> A	LOC_Os04g01510.1	downstream_gene_variant ; 2016.0bp to feature; MODIFIER	silent_mutation	Average:72.918; most accessible tissue: Zhenshan97 flower, score: 87.848	N	N	N	N
vg0400357479	G -> A	LOC_Os04g01520.1	downstream_gene_variant ; 112.0bp to feature; MODIFIER	silent_mutation	Average:72.918; most accessible tissue: Zhenshan97 flower, score: 87.848	N	N	N	N
vg0400357479	G -> A	LOC_Os04g01510.2	downstream_gene_variant ; 2016.0bp to feature; MODIFIER	silent_mutation	Average:72.918; most accessible tissue: Zhenshan97 flower, score: 87.848	N	N	N	N
vg0400357479	G -> A	LOC_Os04g01510-LOC_Os04g01520	intergenic_region ; MODIFIER	silent_mutation	Average:72.918; most accessible tissue: Zhenshan97 flower, score: 87.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400357479	2.64E-07	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	NA	7.39E-09	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	4.80E-08	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	NA	2.27E-09	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	NA	1.66E-09	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	NA	1.16E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	1.03E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	NA	2.53E-08	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	1.40E-06	NA	mr1672	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	4.57E-06	7.92E-07	mr1672	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	NA	8.91E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	2.16E-11	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	3.46E-08	3.56E-11	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	2.57E-06	NA	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	NA	1.00E-06	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	5.75E-06	1.18E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	2.64E-08	6.75E-14	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	5.19E-06	1.01E-10	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	NA	3.65E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	1.72E-07	1.73E-07	mr1703_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	2.11E-07	NA	mr1765_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	6.27E-06	2.58E-08	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400357479	7.90E-07	NA	mr1793_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251