\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400345487:

Variant ID: vg0400345487 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 345487
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGGTGCCACATGGTGTTCTAATAAATTCGGGCAAATATTAGAAATTCTAAGAAAAAAAATCAAAATATCTATTACTTGATTTTCACTTAAATCGGTAG[G/A,C]
TCCAATATTACAAACCGTTAGATTAAATTGATCTTAGAACAAACTAAATACTACGAGGTCCCACCTCGGCATAGGTACGCACCTACGTGCACGGGTACCT

Reverse complement sequence

AGGTACCCGTGCACGTAGGTGCGTACCTATGCCGAGGTGGGACCTCGTAGTATTTAGTTTGTTCTAAGATCAATTTAATCTAACGGTTTGTAATATTGGA[C/T,G]
CTACCGATTTAAGTGAAAATCAAGTAATAGATATTTTGATTTTTTTTCTTAGAATTTCTAATATTTGCCCGAATTTATTAGAACACCATGTGGCACCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 1.80% 0.63% 0.00% C: 0.28%
All Indica  2759 99.50% 0.00% 0.00% 0.00% C: 0.47%
All Japonica  1512 92.40% 5.70% 1.92% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.00% 0.00% C: 0.22%
Indica III  913 98.80% 0.00% 0.00% 0.00% C: 1.20%
Indica Intermediate  786 99.90% 0.00% 0.00% 0.00% C: 0.13%
Temperate Japonica  767 85.30% 11.00% 3.78% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400345487 G -> C LOC_Os04g01500.1 upstream_gene_variant ; 1121.0bp to feature; MODIFIER silent_mutation Average:32.987; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0400345487 G -> C LOC_Os04g01490-LOC_Os04g01500 intergenic_region ; MODIFIER silent_mutation Average:32.987; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0400345487 G -> A LOC_Os04g01500.1 upstream_gene_variant ; 1121.0bp to feature; MODIFIER silent_mutation Average:32.987; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0400345487 G -> A LOC_Os04g01490-LOC_Os04g01500 intergenic_region ; MODIFIER silent_mutation Average:32.987; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400345487 1.51E-06 1.51E-06 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 4.66E-09 3.42E-14 mr1210 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 2.26E-09 1.34E-14 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 1.21E-08 1.21E-08 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 NA 1.50E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 5.97E-08 1.48E-14 mr1585 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 3.29E-08 1.12E-13 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 2.63E-06 2.63E-06 mr1649 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 7.41E-09 4.69E-09 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 NA 2.05E-08 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 3.16E-07 3.16E-07 mr1166_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 1.15E-15 2.24E-20 mr1305_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 1.41E-07 4.76E-07 mr1379_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 4.39E-09 2.33E-11 mr1409_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 5.02E-08 3.27E-09 mr1559_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 7.32E-12 1.67E-19 mr1585_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 5.76E-07 5.76E-07 mr1670_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 2.11E-08 3.15E-08 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 2.18E-06 9.66E-08 mr1703_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 2.84E-10 1.14E-13 mr1765_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400345487 NA 1.92E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251