| Variant ID: vg0400345487 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 345487 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )
CAAGGTGCCACATGGTGTTCTAATAAATTCGGGCAAATATTAGAAATTCTAAGAAAAAAAATCAAAATATCTATTACTTGATTTTCACTTAAATCGGTAG[G/A,C]
TCCAATATTACAAACCGTTAGATTAAATTGATCTTAGAACAAACTAAATACTACGAGGTCCCACCTCGGCATAGGTACGCACCTACGTGCACGGGTACCT
AGGTACCCGTGCACGTAGGTGCGTACCTATGCCGAGGTGGGACCTCGTAGTATTTAGTTTGTTCTAAGATCAATTTAATCTAACGGTTTGTAATATTGGA[C/T,G]
CTACCGATTTAAGTGAAAATCAAGTAATAGATATTTTGATTTTTTTTCTTAGAATTTCTAATATTTGCCCGAATTTATTAGAACACCATGTGGCACCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 1.80% | 0.63% | 0.00% | C: 0.28% |
| All Indica | 2759 | 99.50% | 0.00% | 0.00% | 0.00% | C: 0.47% |
| All Japonica | 1512 | 92.40% | 5.70% | 1.92% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.00% | 0.00% | C: 0.22% |
| Indica III | 913 | 98.80% | 0.00% | 0.00% | 0.00% | C: 1.20% |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.00% | 0.00% | C: 0.13% |
| Temperate Japonica | 767 | 85.30% | 11.00% | 3.78% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400345487 | G -> C | LOC_Os04g01500.1 | upstream_gene_variant ; 1121.0bp to feature; MODIFIER | silent_mutation | Average:32.987; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0400345487 | G -> C | LOC_Os04g01490-LOC_Os04g01500 | intergenic_region ; MODIFIER | silent_mutation | Average:32.987; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0400345487 | G -> A | LOC_Os04g01500.1 | upstream_gene_variant ; 1121.0bp to feature; MODIFIER | silent_mutation | Average:32.987; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0400345487 | G -> A | LOC_Os04g01490-LOC_Os04g01500 | intergenic_region ; MODIFIER | silent_mutation | Average:32.987; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400345487 | 1.51E-06 | 1.51E-06 | mr1166 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400345487 | 4.66E-09 | 3.42E-14 | mr1210 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400345487 | 2.26E-09 | 1.34E-14 | mr1305 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400345487 | 1.21E-08 | 1.21E-08 | mr1409 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400345487 | NA | 1.50E-07 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400345487 | 5.97E-08 | 1.48E-14 | mr1585 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400345487 | 3.29E-08 | 1.12E-13 | mr1586 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400345487 | 2.63E-06 | 2.63E-06 | mr1649 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400345487 | 7.41E-09 | 4.69E-09 | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400345487 | NA | 2.05E-08 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/