Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400287930:

Variant ID: vg0400287930 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 287930
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CTTATTATGCACAAGCTAATGGGCAAGCCGAGGCGTCTAATAAGAGTTTGATTAAGTTGATCAAGCGGAAGATTTCCGATTATCCTCGGCAATGGCATAC[G/T]
CGATTGGCCGAAGCATTGTGGTCTTATAGGATGGCTTGTCATGGATCATCCAAGTTACTCCTTACAAACTTGTTTATGGACATGAGGCTGTGTTGCCATG

Reverse complement sequence

CATGGCAACACAGCCTCATGTCCATAAACAAGTTTGTAAGGAGTAACTTGGATGATCCATGACAAGCCATCCTATAAGACCACAATGCTTCGGCCAATCG[C/A]
GTATGCCATTGCCGAGGATAATCGGAAATCTTCCGCTTGATCAACTTAATCAAACTCTTATTAGACGCCTCGGCTTGCCCATTAGCTTGTGCATAATAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.00%	11.60%	7.28%	8.13%	NA
All Indica	2759	94.50%	1.50%	2.43%	1.63%	NA
All Japonica	1512	36.10%	31.20%	11.51%	21.23%	NA
Aus	269	68.80%	0.40%	27.51%	3.35%	NA
Indica I	595	97.30%	0.30%	1.85%	0.50%	NA
Indica II	465	96.10%	1.10%	1.72%	1.08%	NA
Indica III	913	94.00%	2.10%	2.74%	1.20%	NA
Indica Intermediate	786	91.90%	1.90%	2.93%	3.31%	NA
Temperate Japonica	767	10.30%	57.50%	13.69%	18.51%	NA
Tropical Japonica	504	74.40%	1.60%	5.75%	18.25%	NA
Japonica Intermediate	241	38.20%	9.10%	16.60%	36.10%	NA
VI/Aromatic	96	50.00%	25.00%	21.88%	3.12%	NA
Intermediate	90	73.30%	11.10%	8.89%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400287930	G -> DEL	N	N	silent_mutation	Average:8.747; most accessible tissue: Callus, score: 34.773	N	N	N	N
vg0400287930	G -> T	LOC_Os04g01400.1	downstream_gene_variant ; 141.0bp to feature; MODIFIER	silent_mutation	Average:8.747; most accessible tissue: Callus, score: 34.773	N	N	N	N
vg0400287930	G -> T	LOC_Os04g01410.1	downstream_gene_variant ; 1045.0bp to feature; MODIFIER	silent_mutation	Average:8.747; most accessible tissue: Callus, score: 34.773	N	N	N	N
vg0400287930	G -> T	LOC_Os04g01400-LOC_Os04g01410	intergenic_region ; MODIFIER	silent_mutation	Average:8.747; most accessible tissue: Callus, score: 34.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400287930	NA	1.28E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	3.60E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	3.29E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	2.36E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	1.29E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	2.27E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	1.45E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	8.73E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	3.61E-07	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	2.08E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	6.99E-07	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	2.26E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	2.98E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	7.89E-07	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	3.23E-09	mr1596_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	4.58E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	6.48E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	5.98E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	1.63E-06	mr1751_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	5.40E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	1.23E-06	mr1763_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	2.02E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	1.41E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	5.68E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	2.11E-09	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	4.02E-10	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	4.91E-06	4.91E-06	mr1889_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400287930	NA	3.70E-07	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251