\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400250392:

Variant ID: vg0400250392 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 250392
Reference Allele: AAlternative Allele: T,AT,AAT
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGGCATGAAATTCACTGTTAAGCGGCGCCTGCGAAAATCAGACCACTTAAGCGACGCCTTATGTGGTCCGCCTGCAAAAATAGTACCTACCAAAAAAAA[A/T,AT,AAT]
CTAGTCATCTCATCCTTATCCTCTCCTCCCCACCACTCATTTCCCTCCCCCTCCTCTCTCTCTCTCTCTCCCCCACACTTAGAAAAATCGCCCGGCTCCC

Reverse complement sequence

GGGAGCCGGGCGATTTTTCTAAGTGTGGGGGAGAGAGAGAGAGAGAGGAGGGGGAGGGAAATGAGTGGTGGGGAGGAGAGGATAAGGATGAGATGACTAG[T/A,AT,ATT]
TTTTTTTTGGTAGGTACTATTTTTGCAGGCGGACCACATAAGGCGTCGCTTAAGTGGTCTGATTTTCGCAGGCGCCGCTTAACAGTGAATTTCATGCCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 10.40% 6.14% 1.86% AT: 2.26%; AAT: 0.15%
All Indica  2759 90.30% 0.40% 7.36% 1.49% AT: 0.40%; AAT: 0.11%
All Japonica  1512 58.70% 31.20% 5.22% 2.78% AT: 1.92%; AAT: 0.26%
Aus  269 99.30% 0.00% 0.37% 0.00% AT: 0.37%
Indica I  595 83.20% 0.00% 15.46% 1.34% NA
Indica II  465 88.00% 1.10% 8.39% 2.15% AT: 0.43%
Indica III  913 95.30% 0.00% 2.74% 1.20% AT: 0.44%; AAT: 0.33%
Indica Intermediate  786 91.20% 0.60% 5.98% 1.53% AT: 0.64%
Temperate Japonica  767 36.40% 57.20% 3.52% 0.78% AT: 2.09%
Tropical Japonica  504 86.50% 1.60% 6.15% 3.77% AT: 1.19%; AAT: 0.79%
Japonica Intermediate  241 71.40% 10.00% 8.71% 7.05% AT: 2.90%
VI/Aromatic  96 31.20% 0.00% 0.00% 2.08% AT: 66.67%
Intermediate  90 76.70% 10.00% 7.78% 3.33% AT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400250392 A -> DEL N N silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> AT LOC_Os04g01320.1 upstream_gene_variant ; 1164.0bp to feature; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> AT LOC_Os04g01330.1 upstream_gene_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> AT LOC_Os04g01340.1 downstream_gene_variant ; 1605.0bp to feature; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> AT LOC_Os04g01320-LOC_Os04g01330 intergenic_region ; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> AAT LOC_Os04g01320.1 upstream_gene_variant ; 1164.0bp to feature; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> AAT LOC_Os04g01330.1 upstream_gene_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> AAT LOC_Os04g01340.1 downstream_gene_variant ; 1605.0bp to feature; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> AAT LOC_Os04g01320-LOC_Os04g01330 intergenic_region ; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> T LOC_Os04g01320.1 upstream_gene_variant ; 1163.0bp to feature; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> T LOC_Os04g01330.1 upstream_gene_variant ; 68.0bp to feature; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> T LOC_Os04g01340.1 downstream_gene_variant ; 1606.0bp to feature; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0400250392 A -> T LOC_Os04g01320-LOC_Os04g01330 intergenic_region ; MODIFIER silent_mutation Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0400250392 A AAT -0.15 -0.03 -0.11 0.03 -0.05 -0.03
vg0400250392 A AT -0.22 -0.1 -0.18 -0.02 -0.15 -0.15
vg0400250392 A T -0.16 -0.06 -0.1 -0.04 -0.12 -0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400250392 NA 2.20E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0400250392 NA 2.04E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 1.69E-06 1.69E-06 mr1464 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 2.14E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 2.98E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 6.63E-06 6.63E-06 mr1899 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 6.97E-09 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 1.64E-33 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 3.36E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 4.34E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 2.38E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 5.07E-10 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 1.40E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 1.05E-09 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 1.33E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 5.80E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 5.61E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 1.13E-09 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 6.94E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 2.59E-07 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 6.33E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 1.05E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 2.10E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 1.21E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 1.79E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 2.93E-10 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 9.08E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 4.20E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392 NA 3.08E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251