\
| Variant ID: vg0400233241 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 233241 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
CTGCTTGTGTGTCACTCTACCCTTGATTTATCTTAACCCCTGCTTAGAATATGATTATTACAAGTAACATATAAATTATTAGTCAGGTTCTCTCTACTAT[A/G]
ATCTTTCCACGAGATTAAATAAATACGATACCATTGGAATACTCTCGGGTGAAATGCTACAATGGTATATCCGTGCGCTTGCGGATGAACTCTGTAACCA
TGGTTACAGAGTTCATCCGCAAGCGCACGGATATACCATTGTAGCATTTCACCCGAGAGTATTCCAATGGTATCGTATTTATTTAATCTCGTGGAAAGAT[T/C]
ATAGTAGAGAGAACCTGACTAATAATTTATATGTTACTTGTAATAATCATATTCTAAGCAGGGGTTAAGATAAATCAAGGGTAGAGTGACACACAAGCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.60% | 10.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 68.70% | 31.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 42.40% | 57.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400233241 | A -> G | LOC_Os04g01300.1 | upstream_gene_variant ; 3200.0bp to feature; MODIFIER | silent_mutation | Average:48.491; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0400233241 | A -> G | LOC_Os04g01300.4 | upstream_gene_variant ; 4137.0bp to feature; MODIFIER | silent_mutation | Average:48.491; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0400233241 | A -> G | LOC_Os04g01300.2 | upstream_gene_variant ; 3203.0bp to feature; MODIFIER | silent_mutation | Average:48.491; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0400233241 | A -> G | LOC_Os04g01300.3 | upstream_gene_variant ; 3180.0bp to feature; MODIFIER | silent_mutation | Average:48.491; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg0400233241 | A -> G | LOC_Os04g01300-LOC_Os04g01310 | intergenic_region ; MODIFIER | silent_mutation | Average:48.491; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400233241 | 1.93E-06 | 1.93E-06 | mr1464 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 6.68E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 6.86E-09 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | 8.01E-06 | 8.00E-06 | mr1899 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 8.05E-08 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 5.97E-09 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 7.11E-09 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 3.52E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 1.59E-08 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 7.11E-08 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 2.95E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 6.13E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 5.66E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 3.80E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 7.56E-07 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 3.42E-09 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400233241 | NA | 2.11E-07 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |