Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400167321:

Variant ID: vg0400167321 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 167321
Reference Allele: C	Alternative Allele: A,T
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.06, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

GCATGAGAAATTTGACAAAACATTGACATCTGCAGGCTTCGCAGTCAATGAGGCAGATAAATGTGTGTACTATTGTCATGGTGGGGGTAAGGAAGTTATT[C/A,T]
TGTGTTTGTATGTTGATGACATACTGATATTTGGGACAAACCTTGAGGTGATAAATGAGGTTAAATCATTCTTGTCTCAAAATTTTGATACGAAGGATTT

Reverse complement sequence

AAATCCTTCGTATCAAAATTTTGAGACAAGAATGATTTAACCTCATTTATCACCTCAAGGTTTGTCCCAAATATCAGTATGTCATCAACATACAAACACA[G/T,A]
AATAACTTCCTTACCCCCACCATGACAATAGTACACACATTTATCTGCCTCATTGACTGCGAAGCCTGCAGATGTCAATGTTTTGTCAAATTTCTCATGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	49.30%	0.17%	0.00%	T: 0.15%
All Indica	2759	82.50%	17.30%	0.25%	0.00%	NA
All Japonica	1512	4.30%	95.20%	0.07%	0.00%	T: 0.46%
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	83.20%	16.80%	0.00%	0.00%	NA
Indica II	465	91.60%	8.20%	0.22%	0.00%	NA
Indica III	913	83.20%	16.80%	0.00%	0.00%	NA
Indica Intermediate	786	75.70%	23.50%	0.76%	0.00%	NA
Temperate Japonica	767	0.30%	99.60%	0.13%	0.00%	NA
Tropical Japonica	504	11.10%	87.50%	0.00%	0.00%	T: 1.39%
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	38.90%	61.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400167321	C -> A	LOC_Os04g01210-LOC_Os04g01230	intergenic_region ; MODIFIER	silent_mutation	Average:36.515; most accessible tissue: Zhenshan97 root, score: 50.453	N	N	N	N
vg0400167321	C -> T	LOC_Os04g01210-LOC_Os04g01230	intergenic_region ; MODIFIER	silent_mutation	Average:36.515; most accessible tissue: Zhenshan97 root, score: 50.453	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400167321	NA	7.82E-23	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	3.89E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	8.85E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	3.28E-29	mr1037	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	7.66E-24	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	9.82E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	6.99E-28	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	3.45E-06	mr1187	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	1.99E-16	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.39E-06	mr1279	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	1.88E-13	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.55E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	7.91E-13	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	1.02E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	7.17E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	5.31E-31	mr1426	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	9.90E-06	2.06E-07	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.19E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.07E-47	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	3.34E-08	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	5.07E-06	mr1513	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.51E-11	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	4.90E-29	mr1537	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	7.60E-18	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	8.78E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.61E-09	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	8.41E-21	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	8.58E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	3.10E-07	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.64E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	1.19E-07	3.59E-12	mr1756	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	1.64E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.70E-10	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	7.51E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.25E-56	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	1.43E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	5.93E-06	mr1872	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.36E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.68E-15	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	7.72E-07	4.59E-07	mr1976	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.23E-06	mr1976	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	6.47E-16	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	3.40E-51	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	1.00E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	3.26E-71	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	3.88E-29	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400167321	NA	2.13E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251