Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0400147630:

Variant ID: vg0400147630 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 147630
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCGCTCCGTAGGGATATGACTCCTCGGGGACCTGGCATCTTCATCATCATGTAGGTGTAGTGCGGGACAACCATGAACTTGGCTAACGCCGGGCGTCC[G/A]
AATATGACATGGTACACTGTCTCGAAATCAGCAACTTCGAAGCAAATATTCTCTGTGCGAAAGTTCTCCCAAGTGTCGAAAGTATCCGGCAAAGTGATCT

Reverse complement sequence

AGATCACTTTGCCGGATACTTTCGACACTTGGGAGAACTTTCGCACAGAGAATATTTGCTTCGAAGTTGCTGATTTCGAGACAGTGTACCATGTCATATT[C/T]
GGACGCCCGGCGTTAGCCAAGTTCATGGTTGTCCCGCACTACACCTACATGATGATGAAGATGCCAGGTCCCCGAGGAGTCATATCCCTACGGAGCGACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 26.10% 0.47% 5.65% NA
All Indica  2759 84.00% 7.50% 0.65% 7.83% NA
All Japonica  1512 38.00% 61.80% 0.13% 0.07% NA
Aus  269 83.60% 0.70% 0.37% 15.24% NA
Indica I  595 82.50% 0.70% 1.68% 15.13% NA
Indica II  465 92.90% 3.70% 0.43% 3.01% NA
Indica III  913 82.40% 11.00% 0.22% 6.46% NA
Indica Intermediate  786 81.70% 11.10% 0.51% 6.74% NA
Temperate Japonica  767 9.30% 90.40% 0.26% 0.13% NA
Tropical Japonica  504 71.80% 28.20% 0.00% 0.00% NA
Japonica Intermediate  241 58.90% 41.10% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 66.70% 0.00% 4.17% NA
Intermediate  90 65.60% 27.80% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400147630 G -> DEL LOC_Os04g01210.1 N frameshift_variant Average:54.377; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N
vg0400147630 G -> A LOC_Os04g01210.1 synonymous_variant ; p.Phe342Phe; LOW synonymous_codon Average:54.377; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400147630 NA 6.63E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0400147630 NA 3.28E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 3.30E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 4.99E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 5.19E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 5.72E-06 mr1544 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 8.21E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 7.35E-07 mr1887 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 3.15E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 1.65E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 3.58E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 8.42E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 1.03E-06 NA mr1149_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 1.37E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 4.69E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 5.67E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 1.91E-06 2.06E-10 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 5.37E-08 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 9.21E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 3.45E-08 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 4.53E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 1.53E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 5.60E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 7.54E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 3.61E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 4.40E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 7.01E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 8.45E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 7.30E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 4.26E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 1.86E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 8.55E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400147630 NA 6.33E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251