\
| Variant ID: vg0400132403 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 132403 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 104. )
ATCGGAGGTTTACGTTCAAACTTCCAACTTTTCCATCACATCAAATGTTTGGACATATACATGAAGCATTAAATATGAAAAAAAACTAATTGCATAGTTT[A/G]
CATGTAAATTGCGAGACGAATCTTTTGAGCCTAATTACGCCATGATTTGACAATGTGGTGCTACAGTAAATATTTGTTAATAACAGATTAATTAGGCTTA
TAAGCCTAATTAATCTGTTATTAACAAATATTTACTGTAGCACCACATTGTCAAATCATGGCGTAATTAGGCTCAAAAGATTCGTCTCGCAATTTACATG[T/C]
AAACTATGCAATTAGTTTTTTTTCATATTTAATGCTTCATGTATATGTCCAAACATTTGATGTGATGGAAAAGTTGGAAGTTTGAACGTAAACCTCCGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 19.20% | 1.80% | 0.51% | NA |
| All Indica | 2759 | 94.70% | 1.70% | 2.79% | 0.83% | NA |
| All Japonica | 1512 | 44.60% | 55.20% | 0.13% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.30% | 1.50% | 2.52% | 0.67% | NA |
| Indica II | 465 | 87.10% | 2.40% | 7.96% | 2.58% | NA |
| Indica III | 913 | 98.60% | 0.80% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 94.30% | 2.40% | 2.42% | 0.89% | NA |
| Temperate Japonica | 767 | 12.50% | 87.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 83.70% | 16.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 64.70% | 34.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 25.60% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400132403 | A -> DEL | N | N | silent_mutation | Average:37.092; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0400132403 | A -> G | LOC_Os04g01170.1 | upstream_gene_variant ; 3121.0bp to feature; MODIFIER | silent_mutation | Average:37.092; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0400132403 | A -> G | LOC_Os04g01180.1 | downstream_gene_variant ; 4873.0bp to feature; MODIFIER | silent_mutation | Average:37.092; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0400132403 | A -> G | LOC_Os04g01170-LOC_Os04g01180 | intergenic_region ; MODIFIER | silent_mutation | Average:37.092; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400132403 | NA | 1.15E-09 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0400132403 | NA | 1.39E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 6.52E-08 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 8.24E-08 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 3.35E-06 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 1.18E-06 | mr1550 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 5.82E-08 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 8.41E-17 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 1.67E-08 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 5.71E-07 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 3.60E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 7.85E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 2.61E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 4.13E-08 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 7.15E-06 | mr1045_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 2.71E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 4.85E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 6.89E-07 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 2.02E-07 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 2.91E-08 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 5.84E-09 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 4.04E-06 | mr1236_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 1.26E-13 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 3.00E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 4.78E-09 | mr1251_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | 3.36E-09 | 9.60E-13 | mr1252_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | 6.09E-06 | 1.14E-09 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | 6.44E-07 | 1.35E-08 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | 9.12E-06 | 9.48E-11 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 8.08E-06 | mr1419_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 3.15E-06 | mr1420_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 4.95E-09 | mr1435_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 2.24E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 3.08E-07 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 9.15E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | 3.85E-06 | NA | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 1.25E-08 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 3.22E-08 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 1.89E-09 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 6.36E-10 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 7.91E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 2.09E-06 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 7.00E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 2.93E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 2.83E-06 | mr1668_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 6.05E-07 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 3.91E-07 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 1.85E-06 | mr1729_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 7.69E-07 | mr1739_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 7.41E-10 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 1.45E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 3.39E-06 | mr1751_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 2.25E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 1.33E-07 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 4.46E-08 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 2.63E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 9.07E-06 | mr1813_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 6.11E-09 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 1.07E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 1.37E-08 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 4.98E-08 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 5.85E-09 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 3.91E-06 | mr1887_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400132403 | NA | 9.72E-06 | mr1957_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |