\
| Variant ID: vg0400114187 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 114187 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCTTCCGGATTCACCTAGGCATGAGAGGGGACTGCCCGTTGCCCGCTGGGGACGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGCTAGAGGGGGTTATGC[G/A]
AAGGGTCATGTCACGGCCTCTTTCCGGTATGTCGTGGTGGCATGTCGGCGCATGGAAACGTGTTGTGGGGCTTTGTCTTGTGGTTACAGTTGTACACCTC
GAGGTGTACAACTGTAACCACAAGACAAAGCCCCACAACACGTTTCCATGCGCCGACATGCCACCACGACATACCGGAAAGAGGCCGTGACATGACCCTT[C/T]
GCATAACCCCCTCTAGCCAAGCACACCACACCTCAGGTTTCACCCCCGTCCCCAGCGGGCAACGGGCAGTCCCCTCTCATGCCTAGGTGAATCCGGAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.90% | 17.90% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 87.40% | 12.50% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 68.80% | 30.80% | 0.40% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.50% | 10.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 82.10% | 17.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 90.90% | 9.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 46.60% | 52.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.80% | 54.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 22.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400114187 | G -> A | LOC_Os04g01150.1 | upstream_gene_variant ; 1433.0bp to feature; MODIFIER | silent_mutation | Average:53.214; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg0400114187 | G -> A | LOC_Os04g01140-LOC_Os04g01150 | intergenic_region ; MODIFIER | silent_mutation | Average:53.214; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400114187 | NA | 9.59E-06 | mr1388 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 2.28E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 3.06E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | 6.42E-06 | NA | mr1698 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 7.52E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 3.20E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 1.88E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 8.80E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 3.68E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 3.68E-07 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 5.22E-06 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 1.61E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 2.01E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 3.96E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 4.02E-06 | mr1836_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400114187 | NA | 4.84E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |