\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400103190:

Variant ID: vg0400103190 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 103190
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAAATGTATAGCCTGCCCCAGTCAAACCATTGAGCGAAAACTATTGATCAAGGCCGTGTTTAGTTTCAAAATTTTTTCTTCAAACATTCAATTTTTCC[G/A]
TCACATCAGATATTTGGACACATATAGAGCATTAAATATGAACGAAAAAAACCAATTGCACAGTTTGTATGTAAATCGCGAGATGAATCTTTTGAGCCTA

Reverse complement sequence

TAGGCTCAAAAGATTCATCTCGCGATTTACATACAAACTGTGCAATTGGTTTTTTTCGTTCATATTTAATGCTCTATATGTGTCCAAATATCTGATGTGA[C/T]
GGAAAAATTGAATGTTTGAAGAAAAAATTTTGAAACTAAACACGGCCTTGATCAATAGTTTTCGCTCAATGGTTTGACTGGGGCAGGCTATACATTTTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 41.40% 0.21% 4.85% NA
All Indica  2759 79.60% 15.00% 0.18% 5.18% NA
All Japonica  1512 0.60% 93.70% 0.20% 5.56% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 84.70% 15.10% 0.17% 0.00% NA
Indica II  465 91.20% 7.30% 0.00% 1.51% NA
Indica III  913 78.20% 13.80% 0.33% 7.67% NA
Indica Intermediate  786 70.60% 20.90% 0.13% 8.40% NA
Temperate Japonica  767 0.10% 97.70% 0.13% 2.09% NA
Tropical Japonica  504 0.20% 88.10% 0.40% 11.31% NA
Japonica Intermediate  241 2.90% 92.50% 0.00% 4.56% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 43.30% 52.20% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400103190 G -> DEL N N silent_mutation Average:43.497; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0400103190 G -> A LOC_Os04g01140.1 upstream_gene_variant ; 1547.0bp to feature; MODIFIER silent_mutation Average:43.497; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0400103190 G -> A LOC_Os04g01140.2 upstream_gene_variant ; 1547.0bp to feature; MODIFIER silent_mutation Average:43.497; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0400103190 G -> A LOC_Os04g01140-LOC_Os04g01150 intergenic_region ; MODIFIER silent_mutation Average:43.497; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400103190 NA 4.69E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 4.01E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 2.60E-06 NA mr1293 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 6.88E-06 NA mr1294 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 9.76E-06 9.76E-06 mr1340 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 3.95E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 2.87E-06 mr1426 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 1.89E-06 NA mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 1.50E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 8.85E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 3.10E-06 mr1594 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 1.74E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 3.11E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 8.96E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 4.24E-11 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 9.94E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 4.59E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 2.64E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 1.16E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 1.12E-06 1.12E-06 mr1756 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 3.04E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 1.63E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 1.40E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 5.35E-09 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 4.96E-07 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190 NA 8.13E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251