Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400103190:

Variant ID: vg0400103190 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 103190
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAAATGTATAGCCTGCCCCAGTCAAACCATTGAGCGAAAACTATTGATCAAGGCCGTGTTTAGTTTCAAAATTTTTTCTTCAAACATTCAATTTTTCC[G/A]
TCACATCAGATATTTGGACACATATAGAGCATTAAATATGAACGAAAAAAACCAATTGCACAGTTTGTATGTAAATCGCGAGATGAATCTTTTGAGCCTA

Reverse complement sequence

TAGGCTCAAAAGATTCATCTCGCGATTTACATACAAACTGTGCAATTGGTTTTTTTCGTTCATATTTAATGCTCTATATGTGTCCAAATATCTGATGTGA[C/T]
GGAAAAATTGAATGTTTGAAGAAAAAATTTTGAAACTAAACACGGCCTTGATCAATAGTTTTCGCTCAATGGTTTGACTGGGGCAGGCTATACATTTTCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.50%	41.40%	0.21%	4.85%	NA
All Indica	2759	79.60%	15.00%	0.18%	5.18%	NA
All Japonica	1512	0.60%	93.70%	0.20%	5.56%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	84.70%	15.10%	0.17%	0.00%	NA
Indica II	465	91.20%	7.30%	0.00%	1.51%	NA
Indica III	913	78.20%	13.80%	0.33%	7.67%	NA
Indica Intermediate	786	70.60%	20.90%	0.13%	8.40%	NA
Temperate Japonica	767	0.10%	97.70%	0.13%	2.09%	NA
Tropical Japonica	504	0.20%	88.10%	0.40%	11.31%	NA
Japonica Intermediate	241	2.90%	92.50%	0.00%	4.56%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	43.30%	52.20%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400103190	G -> DEL	N	N	silent_mutation	Average:43.497; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0400103190	G -> A	LOC_Os04g01140.1	upstream_gene_variant ; 1547.0bp to feature; MODIFIER	silent_mutation	Average:43.497; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0400103190	G -> A	LOC_Os04g01140.2	upstream_gene_variant ; 1547.0bp to feature; MODIFIER	silent_mutation	Average:43.497; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0400103190	G -> A	LOC_Os04g01140-LOC_Os04g01150	intergenic_region ; MODIFIER	silent_mutation	Average:43.497; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400103190	NA	4.69E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	4.01E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	2.60E-06	NA	mr1293	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	6.88E-06	NA	mr1294	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	9.76E-06	9.76E-06	mr1340	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	3.95E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	2.87E-06	mr1426	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	1.89E-06	NA	mr1433	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	1.50E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	8.85E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	3.10E-06	mr1594	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	1.74E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	3.11E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	8.96E-12	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	4.24E-11	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	9.94E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	4.59E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	2.64E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	1.16E-06	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	1.12E-06	1.12E-06	mr1756	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	3.04E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	1.63E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	1.40E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	5.35E-09	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	4.96E-07	mr1976	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400103190	NA	8.13E-08	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251