\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400079773:

Variant ID: vg0400079773 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 79773
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGCTGCTGTTAACAATACGTTCAGAGCATATGAGGATATAAGTTCATGGAACAGGTGCCATAATTGTTAATGACTTAATACTGGGCCATGACTAAAGC[C/T]
GATGATTATCAGCAGGTTGTGGACTGCGGGTAAAGCGTACATCTGCTGCAGTAGAATATCTTTGAAACTATTCGAATAGTCGTACTCATGGAGTTGAGTA

Reverse complement sequence

TACTCAACTCCATGAGTACGACTATTCGAATAGTTTCAAAGATATTCTACTGCAGCAGATGTACGCTTTACCCGCAGTCCACAACCTGCTGATAATCATC[G/A]
GCTTTAGTCATGGCCCAGTATTAAGTCATTAACAATTATGGCACCTGTTCCATGAACTTATATCCTCATATGCTCTGAACGTATTGTTAACAGCAGCAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 44.60% 1.48% 0.04% NA
All Indica  2759 24.50% 73.00% 2.46% 0.07% NA
All Japonica  1512 96.00% 3.90% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 16.10% 81.30% 2.52% 0.00% NA
Indica II  465 12.90% 83.20% 3.87% 0.00% NA
Indica III  913 27.50% 70.10% 2.19% 0.22% NA
Indica Intermediate  786 34.10% 64.00% 1.91% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 89.30% 10.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400079773 C -> DEL N N silent_mutation Average:21.547; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg0400079773 C -> T LOC_Os04g01120.1 downstream_gene_variant ; 2853.0bp to feature; MODIFIER silent_mutation Average:21.547; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg0400079773 C -> T LOC_Os04g01124.1 downstream_gene_variant ; 3209.0bp to feature; MODIFIER silent_mutation Average:21.547; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg0400079773 C -> T LOC_Os04g01120-LOC_Os04g01124 intergenic_region ; MODIFIER silent_mutation Average:21.547; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400079773 NA 9.35E-28 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 4.22E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 2.33E-11 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 1.33E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 4.36E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 1.36E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 7.83E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 7.34E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 5.48E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 6.69E-10 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 2.87E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 1.26E-06 2.15E-55 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 6.66E-08 mr1798 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 1.60E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 2.57E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 7.80E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773 NA 1.55E-07 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251