Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400079773:

Variant ID: vg0400079773 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 79773
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGCTGCTGTTAACAATACGTTCAGAGCATATGAGGATATAAGTTCATGGAACAGGTGCCATAATTGTTAATGACTTAATACTGGGCCATGACTAAAGC[C/T]
GATGATTATCAGCAGGTTGTGGACTGCGGGTAAAGCGTACATCTGCTGCAGTAGAATATCTTTGAAACTATTCGAATAGTCGTACTCATGGAGTTGAGTA

Reverse complement sequence

TACTCAACTCCATGAGTACGACTATTCGAATAGTTTCAAAGATATTCTACTGCAGCAGATGTACGCTTTACCCGCAGTCCACAACCTGCTGATAATCATC[G/A]
GCTTTAGTCATGGCCCAGTATTAAGTCATTAACAATTATGGCACCTGTTCCATGAACTTATATCCTCATATGCTCTGAACGTATTGTTAACAGCAGCAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.90%	44.60%	1.48%	0.04%	NA
All Indica	2759	24.50%	73.00%	2.46%	0.07%	NA
All Japonica	1512	96.00%	3.90%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	16.10%	81.30%	2.52%	0.00%	NA
Indica II	465	12.90%	83.20%	3.87%	0.00%	NA
Indica III	913	27.50%	70.10%	2.19%	0.22%	NA
Indica Intermediate	786	34.10%	64.00%	1.91%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	89.30%	10.70%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	1.70%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	63.30%	35.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400079773	C -> DEL	N	N	silent_mutation	Average:21.547; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N
vg0400079773	C -> T	LOC_Os04g01120.1	downstream_gene_variant ; 2853.0bp to feature; MODIFIER	silent_mutation	Average:21.547; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N
vg0400079773	C -> T	LOC_Os04g01124.1	downstream_gene_variant ; 3209.0bp to feature; MODIFIER	silent_mutation	Average:21.547; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N
vg0400079773	C -> T	LOC_Os04g01120-LOC_Os04g01124	intergenic_region ; MODIFIER	silent_mutation	Average:21.547; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400079773	NA	9.35E-28	mr1037	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	4.22E-14	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	2.33E-11	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	1.33E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	4.36E-10	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	1.36E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	7.83E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	7.34E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	5.48E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	6.69E-10	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	2.87E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	1.26E-06	2.15E-55	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	6.66E-08	mr1798	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	1.60E-06	mr1976	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	2.57E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	7.80E-09	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400079773	NA	1.55E-07	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251