\
| Variant ID: vg0400052458 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 52458 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, C: 0.09, others allele: 0.00, population size: 45. )
TGCCGTGTAATCCATGCATTGGACTTACCGATGTTCCTGGCGCGAACTACAGCCAAGTGCTCCTCGATGTAAGGAGCTACCAATGAAGAGTGTTGCAGAA[T/C]
AGTGAAATGGGCTTTACAGAATAAATTGTTGTCTACCATCATTATTGCTTTCCTTCCTAGAGTTCCCTTTCCCCGTAGTCTCCCTTCATGGCGTGATTCA
TGAATCACGCCATGAAGGGAGACTACGGGGAAAGGGAACTCTAGGAAGGAAAGCAATAATGATGGTAGACAACAATTTATTCTGTAAAGCCCATTTCACT[A/G]
TTCTGCAACACTCTTCATTGGTAGCTCCTTACATCGAGGAGCACTTGGCTGTAGTTCGCGCCAGGAACATCGGTAAGTCCAATGCATGGATTACACGGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 19.50% | 6.01% | 16.46% | NA |
| All Indica | 2759 | 93.20% | 2.10% | 1.88% | 2.79% | NA |
| All Japonica | 1512 | 5.80% | 55.50% | 3.57% | 35.19% | NA |
| Aus | 269 | 9.70% | 1.50% | 57.62% | 31.23% | NA |
| Indica I | 595 | 96.30% | 2.50% | 0.67% | 0.50% | NA |
| Indica II | 465 | 95.50% | 2.20% | 1.08% | 1.29% | NA |
| Indica III | 913 | 95.40% | 1.40% | 1.64% | 1.53% | NA |
| Indica Intermediate | 786 | 87.00% | 2.50% | 3.56% | 6.87% | NA |
| Temperate Japonica | 767 | 1.80% | 87.40% | 0.26% | 10.56% | NA |
| Tropical Japonica | 504 | 10.70% | 16.30% | 9.33% | 63.69% | NA |
| Japonica Intermediate | 241 | 7.90% | 36.10% | 2.07% | 53.94% | NA |
| VI/Aromatic | 96 | 8.30% | 1.00% | 13.54% | 77.08% | NA |
| Intermediate | 90 | 54.40% | 22.20% | 11.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400052458 | T -> C | LOC_Os04g01060.1 | missense_variant ; p.Ile705Val; MODERATE | nonsynonymous_codon ; I705V | Average:13.418; most accessible tissue: Callus, score: 27.12 | benign |
-0.408 |
TOLERATED | 1.00 |
| vg0400052458 | T -> DEL | LOC_Os04g01060.1 | N | frameshift_variant | Average:13.418; most accessible tissue: Callus, score: 27.12 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400052458 | 1.95E-06 | NA | mr1059 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 4.23E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 4.50E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 1.05E-09 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 2.72E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 6.85E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 1.19E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 7.81E-07 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 1.74E-06 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 1.38E-08 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 2.60E-09 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 3.51E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400052458 | NA | 1.51E-08 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |