\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400019945:

Variant ID: vg0400019945 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 19945
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, C: 0.20, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGTAGCTCTTCTGTCGAGACTGGGCAATCCTCAACCTCTCCCTGATGGTTCTGACTTTCTCTTTTGCTTCCGCTAATACCTCTGTCCCGAACAGTTGA[T/C]
GCTCGCCTGTCTGATCCCAGAAGAGAGGTGTGCGGCACTTCCGGCCATATAAAGCTTCAAACGGTGCCATCTGTAGACTGGCCTGGTAGCTGTTGTTGTA

Reverse complement sequence

TACAACAACAGCTACCAGGCCAGTCTACAGATGGCACCGTTTGAAGCTTTATATGGCCGGAAGTGCCGCACACCTCTCTTCTGGGATCAGACAGGCGAGC[A/G]
TCAACTGTTCGGGACAGAGGTATTAGCGGAAGCAAAAGAGAAAGTCAGAACCATCAGGGAGAGGTTGAGGATTGCCCAGTCTCGACAGAAGAGCTACGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.30% 22.20% 35.72% 18.79% NA
All Indica  2759 11.60% 27.90% 53.90% 6.60% NA
All Japonica  1512 49.00% 0.70% 8.66% 41.60% NA
Aus  269 4.10% 87.00% 8.92% 0.00% NA
Indica I  595 18.70% 23.50% 52.61% 5.21% NA
Indica II  465 5.40% 27.70% 61.94% 4.95% NA
Indica III  913 9.60% 32.60% 54.33% 3.40% NA
Indica Intermediate  786 12.10% 26.00% 49.62% 12.34% NA
Temperate Japonica  767 74.70% 0.30% 2.09% 22.95% NA
Tropical Japonica  504 16.70% 1.00% 15.67% 66.67% NA
Japonica Intermediate  241 34.90% 1.70% 14.94% 48.55% NA
VI/Aromatic  96 1.00% 22.90% 8.33% 67.71% NA
Intermediate  90 31.10% 13.30% 42.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400019945 T -> C LOC_Os04g01030.1 missense_variant ; p.His1263Arg; MODERATE nonsynonymous_codon ; H1263R Average:23.746; most accessible tissue: Minghui63 young leaf, score: 42.042 benign -0.672 TOLERATED 1.00
vg0400019945 T -> DEL LOC_Os04g01030.1 N frameshift_variant Average:23.746; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400019945 NA 2.97E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 1.61E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 3.37E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 4.12E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 1.69E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 1.47E-06 9.87E-08 mr1976 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 1.21E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 6.31E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 1.04E-09 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 1.44E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 3.32E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 4.95E-06 4.95E-06 mr1267_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 4.27E-06 4.27E-06 mr1337_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 8.51E-06 8.50E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 8.13E-06 NA mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 9.48E-07 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 8.21E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 3.57E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 1.89E-09 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 2.58E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 1.02E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 4.65E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400019945 NA 5.54E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251