\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400014283:

Variant ID: vg0400014283 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14283
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


TCATGGTTTTCTGAGGACGTCCACCTTCCAGCCTCTTAGGAAGTGGCTCCAACAGCATAAAAATCATCATACAATATCTCATCCCACACAAGTTAAGAAT[C/T]
TAGAGTCTAGCCAAGTGTAATACACGTCCCGGTGCTTAGTAACCATGAGCACAGCTATTCGAATAGATTTAGTTTACTCACACTGCAGTGGATGTACACT

Reverse complement sequence

AGTGTACATCCACTGCAGTGTGAGTAAACTAAATCTATTCGAATAGCTGTGCTCATGGTTACTAAGCACCGGGACGTGTATTACACTTGGCTAGACTCTA[G/A]
ATTCTTAACTTGTGTGGGATGAGATATTGTATGATGATTTTTATGCTGTTGGAGCCACTTCCTAAGAGGCTGGAAGGTGGACGTCCTCAGAAAACCATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.40% 13.50% 25.48% 20.61% NA
All Indica  2759 46.20% 1.70% 30.88% 21.13% NA
All Japonica  1512 20.30% 38.10% 20.70% 20.90% NA
Aus  269 97.40% 0.40% 1.12% 1.12% NA
Indica I  595 42.90% 2.00% 40.00% 15.13% NA
Indica II  465 41.10% 1.30% 32.69% 24.95% NA
Indica III  913 57.00% 0.70% 23.66% 18.73% NA
Indica Intermediate  786 39.40% 3.10% 31.30% 26.21% NA
Temperate Japonica  767 23.50% 61.80% 6.26% 8.47% NA
Tropical Japonica  504 16.30% 10.50% 35.91% 37.30% NA
Japonica Intermediate  241 18.70% 20.30% 34.85% 26.14% NA
VI/Aromatic  96 27.10% 0.00% 10.42% 62.50% NA
Intermediate  90 41.10% 16.70% 28.89% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400014283 C -> DEL N N silent_mutation Average:27.403; most accessible tissue: Callus, score: 37.101 N N N N
vg0400014283 C -> T LOC_Os04g01020.1 upstream_gene_variant ; 3882.0bp to feature; MODIFIER silent_mutation Average:27.403; most accessible tissue: Callus, score: 37.101 N N N N
vg0400014283 C -> T LOC_Os04g01010.1 downstream_gene_variant ; 2987.0bp to feature; MODIFIER silent_mutation Average:27.403; most accessible tissue: Callus, score: 37.101 N N N N
vg0400014283 C -> T LOC_Os04g01010-LOC_Os04g01020 intergenic_region ; MODIFIER silent_mutation Average:27.403; most accessible tissue: Callus, score: 37.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400014283 5.31E-08 NA mr1672 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283 4.28E-06 NA mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283 NA 3.23E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283 NA 2.10E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283 NA 1.29E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283 NA 7.56E-09 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283 NA 3.80E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283 NA 4.73E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283 NA 9.55E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283 3.64E-15 NA mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283 3.65E-13 NA mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251