\
| Variant ID: vg0400014283 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14283 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 32. )
TCATGGTTTTCTGAGGACGTCCACCTTCCAGCCTCTTAGGAAGTGGCTCCAACAGCATAAAAATCATCATACAATATCTCATCCCACACAAGTTAAGAAT[C/T]
TAGAGTCTAGCCAAGTGTAATACACGTCCCGGTGCTTAGTAACCATGAGCACAGCTATTCGAATAGATTTAGTTTACTCACACTGCAGTGGATGTACACT
AGTGTACATCCACTGCAGTGTGAGTAAACTAAATCTATTCGAATAGCTGTGCTCATGGTTACTAAGCACCGGGACGTGTATTACACTTGGCTAGACTCTA[G/A]
ATTCTTAACTTGTGTGGGATGAGATATTGTATGATGATTTTTATGCTGTTGGAGCCACTTCCTAAGAGGCTGGAAGGTGGACGTCCTCAGAAAACCATGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.40% | 13.50% | 25.48% | 20.61% | NA |
| All Indica | 2759 | 46.20% | 1.70% | 30.88% | 21.13% | NA |
| All Japonica | 1512 | 20.30% | 38.10% | 20.70% | 20.90% | NA |
| Aus | 269 | 97.40% | 0.40% | 1.12% | 1.12% | NA |
| Indica I | 595 | 42.90% | 2.00% | 40.00% | 15.13% | NA |
| Indica II | 465 | 41.10% | 1.30% | 32.69% | 24.95% | NA |
| Indica III | 913 | 57.00% | 0.70% | 23.66% | 18.73% | NA |
| Indica Intermediate | 786 | 39.40% | 3.10% | 31.30% | 26.21% | NA |
| Temperate Japonica | 767 | 23.50% | 61.80% | 6.26% | 8.47% | NA |
| Tropical Japonica | 504 | 16.30% | 10.50% | 35.91% | 37.30% | NA |
| Japonica Intermediate | 241 | 18.70% | 20.30% | 34.85% | 26.14% | NA |
| VI/Aromatic | 96 | 27.10% | 0.00% | 10.42% | 62.50% | NA |
| Intermediate | 90 | 41.10% | 16.70% | 28.89% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400014283 | C -> DEL | N | N | silent_mutation | Average:27.403; most accessible tissue: Callus, score: 37.101 | N | N | N | N |
| vg0400014283 | C -> T | LOC_Os04g01020.1 | upstream_gene_variant ; 3882.0bp to feature; MODIFIER | silent_mutation | Average:27.403; most accessible tissue: Callus, score: 37.101 | N | N | N | N |
| vg0400014283 | C -> T | LOC_Os04g01010.1 | downstream_gene_variant ; 2987.0bp to feature; MODIFIER | silent_mutation | Average:27.403; most accessible tissue: Callus, score: 37.101 | N | N | N | N |
| vg0400014283 | C -> T | LOC_Os04g01010-LOC_Os04g01020 | intergenic_region ; MODIFIER | silent_mutation | Average:27.403; most accessible tissue: Callus, score: 37.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400014283 | 5.31E-08 | NA | mr1672 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400014283 | 4.28E-06 | NA | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400014283 | NA | 3.23E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400014283 | NA | 2.10E-09 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400014283 | NA | 1.29E-06 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400014283 | NA | 7.56E-09 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400014283 | NA | 3.80E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400014283 | NA | 4.73E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400014283 | NA | 9.55E-07 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400014283 | 3.64E-15 | NA | mr1672_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400014283 | 3.65E-13 | NA | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |