Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400014283:

Variant ID: vg0400014283 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14283
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:

TCATGGTTTTCTGAGGACGTCCACCTTCCAGCCTCTTAGGAAGTGGCTCCAACAGCATAAAAATCATCATACAATATCTCATCCCACACAAGTTAAGAAT[C/T]
TAGAGTCTAGCCAAGTGTAATACACGTCCCGGTGCTTAGTAACCATGAGCACAGCTATTCGAATAGATTTAGTTTACTCACACTGCAGTGGATGTACACT

Reverse complement sequence

AGTGTACATCCACTGCAGTGTGAGTAAACTAAATCTATTCGAATAGCTGTGCTCATGGTTACTAAGCACCGGGACGTGTATTACACTTGGCTAGACTCTA[G/A]
ATTCTTAACTTGTGTGGGATGAGATATTGTATGATGATTTTTATGCTGTTGGAGCCACTTCCTAAGAGGCTGGAAGGTGGACGTCCTCAGAAAACCATGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.40%	13.50%	25.48%	20.61%	NA
All Indica	2759	46.20%	1.70%	30.88%	21.13%	NA
All Japonica	1512	20.30%	38.10%	20.70%	20.90%	NA
Aus	269	97.40%	0.40%	1.12%	1.12%	NA
Indica I	595	42.90%	2.00%	40.00%	15.13%	NA
Indica II	465	41.10%	1.30%	32.69%	24.95%	NA
Indica III	913	57.00%	0.70%	23.66%	18.73%	NA
Indica Intermediate	786	39.40%	3.10%	31.30%	26.21%	NA
Temperate Japonica	767	23.50%	61.80%	6.26%	8.47%	NA
Tropical Japonica	504	16.30%	10.50%	35.91%	37.30%	NA
Japonica Intermediate	241	18.70%	20.30%	34.85%	26.14%	NA
VI/Aromatic	96	27.10%	0.00%	10.42%	62.50%	NA
Intermediate	90	41.10%	16.70%	28.89%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400014283	C -> DEL	N	N	silent_mutation	Average:27.403; most accessible tissue: Callus, score: 37.101	N	N	N	N
vg0400014283	C -> T	LOC_Os04g01020.1	upstream_gene_variant ; 3882.0bp to feature; MODIFIER	silent_mutation	Average:27.403; most accessible tissue: Callus, score: 37.101	N	N	N	N
vg0400014283	C -> T	LOC_Os04g01010.1	downstream_gene_variant ; 2987.0bp to feature; MODIFIER	silent_mutation	Average:27.403; most accessible tissue: Callus, score: 37.101	N	N	N	N
vg0400014283	C -> T	LOC_Os04g01010-LOC_Os04g01020	intergenic_region ; MODIFIER	silent_mutation	Average:27.403; most accessible tissue: Callus, score: 37.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400014283	5.31E-08	NA	mr1672	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283	4.28E-06	NA	mr1672	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283	NA	3.23E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283	NA	2.10E-09	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283	NA	1.29E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283	NA	7.56E-09	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283	NA	3.80E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283	NA	4.73E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283	NA	9.55E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283	3.64E-15	NA	mr1672_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400014283	3.65E-13	NA	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251