\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400009811:

Variant ID: vg0400009811 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9811
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCCTCGTCAGCGGTGTCAGAGGTGGTTGGCGGGCGCGTAGTGCATATTTATGTCGTCCCACTACGCGCCTGATCTTCTGTTTCACACCCAGGGCTCTC[A/G]
AAGCCCAGGTTTCTTCTGAGGCCCTTGGACAGCCTCGGAAGCCTTGACTACCTCTGGAGCCCTTGGACCGCTCCGGAGGACATGGAGTGCTCTGGAGGAC

Reverse complement sequence

GTCCTCCAGAGCACTCCATGTCCTCCGGAGCGGTCCAAGGGCTCCAGAGGTAGTCAAGGCTTCCGAGGCTGTCCAAGGGCCTCAGAAGAAACCTGGGCTT[T/C]
GAGAGCCCTGGGTGTGAAACAGAAGATCAGGCGCGTAGTGGGACGACATAAATATGCACTACGCGCCCGCCAACCACCTCTGACACCGCTGACGAGGGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 37.80% 2.22% 3.72% NA
All Indica  2759 78.20% 19.40% 0.33% 2.10% NA
All Japonica  1512 29.30% 61.50% 5.75% 3.44% NA
Aus  269 0.70% 97.00% 1.12% 1.12% NA
Indica I  595 85.20% 14.30% 0.34% 0.17% NA
Indica II  465 90.30% 8.80% 0.00% 0.86% NA
Indica III  913 75.10% 19.90% 0.22% 4.71% NA
Indica Intermediate  786 69.20% 28.90% 0.64% 1.27% NA
Temperate Japonica  767 44.60% 44.20% 9.91% 1.30% NA
Tropical Japonica  504 13.70% 78.40% 0.79% 7.14% NA
Japonica Intermediate  241 13.30% 81.30% 2.90% 2.49% NA
VI/Aromatic  96 10.40% 30.20% 0.00% 59.38% NA
Intermediate  90 50.00% 36.70% 6.67% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400009811 A -> DEL N N silent_mutation Average:77.17; most accessible tissue: Zhenshan97 young leaf, score: 93.227 N N N N
vg0400009811 A -> G LOC_Os04g01008.1 upstream_gene_variant ; 1175.0bp to feature; MODIFIER silent_mutation Average:77.17; most accessible tissue: Zhenshan97 young leaf, score: 93.227 N N N N
vg0400009811 A -> G LOC_Os04g01010.1 upstream_gene_variant ; 710.0bp to feature; MODIFIER silent_mutation Average:77.17; most accessible tissue: Zhenshan97 young leaf, score: 93.227 N N N N
vg0400009811 A -> G LOC_Os04g01008-LOC_Os04g01010 intergenic_region ; MODIFIER silent_mutation Average:77.17; most accessible tissue: Zhenshan97 young leaf, score: 93.227 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0400009811 A G -0.01 -0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400009811 NA 1.60E-06 mr1187 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 2.76E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 3.57E-06 mr1279 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 3.09E-14 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 3.32E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 5.06E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 9.06E-06 mr1426 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 1.31E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 8.13E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 2.81E-10 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 8.07E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 1.61E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 1.75E-08 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 2.36E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 4.45E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 8.14E-06 7.73E-12 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 1.19E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 3.24E-06 5.89E-09 mr1976 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 8.39E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 1.15E-20 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 2.42E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 4.69E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 3.10E-07 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400009811 NA 8.00E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251