\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400008206:

Variant ID: vg0400008206 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8206
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.05, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGCCATGACCCCTGCCTCAGCCGCGGCCAGTGGAACCCCGTGTCTGCTCCGCAGGGACCGTCTCTACGATGTTAACTTCACGGCGCCCCTTTGGCTTG[C/A]
GGGCGTGCCTATCCCGGGCGACTTGCGGCTCCTGCCATGGCCACTACGGGTGCCTGGGTTGGAGCCTGCGGAGCAGGTGCTTGCGGAGGCGGCATCCCAG

Reverse complement sequence

CTGGGATGCCGCCTCCGCAAGCACCTGCTCCGCAGGCTCCAACCCAGGCACCCGTAGTGGCCATGGCAGGAGCCGCAAGTCGCCCGGGATAGGCACGCCC[G/T]
CAAGCCAAAGGGGCGCCGTGAAGTTAACATCGTAGAGACGGTCCCTGCGGAGCAGACACGGGGTTCCACTGGCCGCGGCTGAGGCAGGGGTCATGGCAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 47.00% 0.66% 3.28% NA
All Indica  2759 20.80% 76.70% 0.72% 1.81% NA
All Japonica  1512 92.50% 4.20% 0.53% 2.84% NA
Aus  269 98.50% 0.40% 0.37% 0.74% NA
Indica I  595 16.30% 82.40% 1.34% 0.00% NA
Indica II  465 9.70% 89.00% 0.65% 0.65% NA
Indica III  913 20.60% 74.70% 0.22% 4.49% NA
Indica Intermediate  786 31.00% 67.30% 0.89% 0.76% NA
Temperate Japonica  767 98.60% 0.10% 0.13% 1.17% NA
Tropical Japonica  504 81.90% 10.90% 1.19% 5.95% NA
Japonica Intermediate  241 95.00% 2.90% 0.41% 1.66% NA
VI/Aromatic  96 31.20% 8.30% 0.00% 60.42% NA
Intermediate  90 58.90% 36.70% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400008206 C -> DEL N N silent_mutation Average:78.571; most accessible tissue: Zhenshan97 young leaf, score: 93.963 N N N N
vg0400008206 C -> A LOC_Os04g01010.1 upstream_gene_variant ; 2315.0bp to feature; MODIFIER silent_mutation Average:78.571; most accessible tissue: Zhenshan97 young leaf, score: 93.963 N N N N
vg0400008206 C -> A LOC_Os04g01006.1 downstream_gene_variant ; 4527.0bp to feature; MODIFIER silent_mutation Average:78.571; most accessible tissue: Zhenshan97 young leaf, score: 93.963 N N N N
vg0400008206 C -> A LOC_Os04g01008.1 intron_variant ; MODIFIER silent_mutation Average:78.571; most accessible tissue: Zhenshan97 young leaf, score: 93.963 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0400008206 C A 0.0 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400008206 NA 5.47E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 5.49E-29 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 3.37E-15 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 1.60E-12 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 3.36E-14 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 2.62E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 3.51E-42 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 1.68E-13 mr1524 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 3.00E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 1.10E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 7.76E-09 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 5.54E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 6.11E-10 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 5.63E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 7.86E-57 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 6.87E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 2.40E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 3.60E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 2.98E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 1.42E-50 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 3.84E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 4.14E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400008206 NA 7.73E-68 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251