\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400006669:

Variant ID: vg0400006669 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 6669
Reference Allele: GAlternative Allele: A,GCA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATGCCCCGAAAATGGGCCACCACCTTGCGGAAGGCCTCCAGGTACTTGGTGAGTTCCGGGCTCCGCGCCTGGTACGACTTGTCAATGTGCCCCGCGGC[G/A,GCA]
AGTCGGTGTGGATGACGAGGCGCGGAGCCCCCATGGCTCTTGCTTTGCGGAGGTCCAACATGATGGCCTCGTACTCAGCAATGTTATTGGTGGCCGGGAA

Reverse complement sequence

TTCCCGGCCACCAATAACATTGCTGAGTACGAGGCCATCATGTTGGACCTCCGCAAAGCAAGAGCCATGGGGGCTCCGCGCCTCGTCATCCACACCGACT[C/T,TGC]
GCCGCGGGGCACATTGACAAGTCGTACCAGGCGCGGAGCCCGGAACTCACCAAGTACCTGGAGGCCTTCCGCAAGGTGGTGGCCCATTTTCGGGGCATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 7.70% 0.21% 3.09% GCA: 0.17%
All Indica  2759 92.60% 5.40% 0.14% 1.78% GCA: 0.07%
All Japonica  1512 83.10% 13.80% 0.33% 2.45% GCA: 0.33%
Aus  269 98.90% 0.00% 0.37% 0.74% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 1.50% 0.00% 0.65% NA
Indica III  913 87.20% 8.10% 0.44% 4.27% NA
Indica Intermediate  786 90.10% 8.80% 0.00% 0.89% GCA: 0.25%
Temperate Japonica  767 81.20% 17.50% 0.13% 1.17% NA
Tropical Japonica  504 81.30% 11.90% 0.79% 4.96% GCA: 0.99%
Japonica Intermediate  241 92.50% 6.20% 0.00% 1.24% NA
VI/Aromatic  96 41.70% 0.00% 0.00% 58.33% NA
Intermediate  90 92.20% 4.40% 0.00% 2.22% GCA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400006669 G -> DEL N N silent_mutation Average:71.523; most accessible tissue: Zhenshan97 young leaf, score: 93.805 N N N N
vg0400006669 G -> GCA LOC_Os04g01010.1 upstream_gene_variant ; 3851.0bp to feature; MODIFIER silent_mutation Average:71.523; most accessible tissue: Zhenshan97 young leaf, score: 93.805 N N N N
vg0400006669 G -> GCA LOC_Os04g01006.1 downstream_gene_variant ; 2991.0bp to feature; MODIFIER silent_mutation Average:71.523; most accessible tissue: Zhenshan97 young leaf, score: 93.805 N N N N
vg0400006669 G -> GCA LOC_Os04g01008.1 intron_variant ; MODIFIER silent_mutation Average:71.523; most accessible tissue: Zhenshan97 young leaf, score: 93.805 N N N N
vg0400006669 G -> A LOC_Os04g01010.1 upstream_gene_variant ; 3852.0bp to feature; MODIFIER silent_mutation Average:71.523; most accessible tissue: Zhenshan97 young leaf, score: 93.805 N N N N
vg0400006669 G -> A LOC_Os04g01006.1 downstream_gene_variant ; 2990.0bp to feature; MODIFIER silent_mutation Average:71.523; most accessible tissue: Zhenshan97 young leaf, score: 93.805 N N N N
vg0400006669 G -> A LOC_Os04g01008.1 intron_variant ; MODIFIER silent_mutation Average:71.523; most accessible tissue: Zhenshan97 young leaf, score: 93.805 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0400006669 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01
vg0400006669 G GCA 0.01 0.03 0.02 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400006669 1.72E-06 1.23E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400006669 2.18E-06 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400006669 9.42E-07 5.62E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400006669 2.07E-06 NA mr1670_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251