Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400005711:

Variant ID: vg0400005711 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5711
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, T: 0.47, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGGAGAACAGATCGACTAAGACCTGCAAAAAGAAAATTAAAGATGAGTAAACATCAAAACATATTATACAACCGATCTGAGATTTCTGAAGATGAAAA[T/A]
CTTACTGGTATGACATGAGCAGCTTGTTGTTCCTCTTCCTCAATTTGGTGGCTGCCCATAGCCGATGGAGTATGATCACTGGACATCGGCTGCACATGAG

Reverse complement sequence

CTCATGTGCAGCCGATGTCCAGTGATCATACTCCATCGGCTATGGGCAGCCACCAAATTGAGGAAGAGGAACAACAAGCTGCTCATGTCATACCAGTAAG[A/T]
TTTTCATCTTCAGAAATCTCAGATCGGTTGTATAATATGTTTTGATGTTTACTCATCTTTAATTTTCTTTTTGCAGGTCTTAGTCGATCTGTTCTCCTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 18.90% 0.19% 7.28% NA
All Indica  2759 90.10% 1.40% 0.18% 8.30% NA
All Japonica  1512 41.40% 55.20% 0.20% 3.24% NA
Aus  269 98.10% 1.10% 0.00% 0.74% NA
Indica I  595 85.70% 2.00% 0.17% 12.10% NA
Indica II  465 95.50% 1.10% 0.22% 3.23% NA
Indica III  913 89.60% 0.70% 0.11% 9.64% NA
Indica Intermediate  786 90.80% 2.00% 0.25% 6.87% NA
Temperate Japonica  767 11.70% 87.00% 0.13% 1.17% NA
Tropical Japonica  504 76.60% 16.30% 0.20% 6.94% NA
Japonica Intermediate  241 62.20% 35.30% 0.41% 2.07% NA
VI/Aromatic  96 37.50% 1.00% 0.00% 61.46% NA
Intermediate  90 73.30% 20.00% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400005711 T -> DEL N N silent_mutation Average:74.136; most accessible tissue: Zhenshan97 young leaf, score: 94.359 N N N N
vg0400005711 T -> A LOC_Os04g01008.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:74.136; most accessible tissue: Zhenshan97 young leaf, score: 94.359 N N N N
vg0400005711 T -> A LOC_Os04g01010.1 upstream_gene_variant ; 4810.0bp to feature; MODIFIER silent_mutation Average:74.136; most accessible tissue: Zhenshan97 young leaf, score: 94.359 N N N N
vg0400005711 T -> A LOC_Os04g01006.1 downstream_gene_variant ; 2032.0bp to feature; MODIFIER silent_mutation Average:74.136; most accessible tissue: Zhenshan97 young leaf, score: 94.359 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400005711 NA 3.12E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.23E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 6.77E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 1.09E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 7.65E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 4.01E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 5.62E-09 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.30E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 5.81E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 7.04E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 1.11E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 7.74E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 5.02E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 6.07E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 4.24E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.25E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 6.70E-08 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 7.60E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 5.61E-09 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.07E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 3.38E-14 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 1.81E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 5.55E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 1.62E-06 2.01E-37 mr1251_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 3.41E-09 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 8.33E-08 2.56E-11 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 6.53E-06 3.75E-09 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 2.07E-06 7.56E-08 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 3.88E-06 7.08E-11 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 6.58E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 7.93E-06 mr1420_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 1.63E-06 1.66E-37 mr1435_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 3.52E-09 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 7.13E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.02E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 4.30E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 2.83E-06 NA mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.56E-08 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 1.38E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 1.88E-10 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 1.18E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 4.63E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 8.49E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 1.04E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 1.61E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.53E-07 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 9.94E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.26E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 9.68E-17 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.29E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 4.79E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 3.20E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 1.61E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 5.71E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.17E-27 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 5.64E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 8.42E-09 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 4.40E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 5.58E-29 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 2.98E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 6.88E-12 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 3.45E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 6.54E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 5.19E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400005711 NA 5.73E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251