\
| Variant ID: vg0400003186 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3186 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTGATACGTTGCTAATCTACAACCAGAAGTGCCGAAAATTGATGGATAGTAATTTTGAAAATTGATATGATAGCTTTCGGTTAGTAATTTTGAAACATGT[T/A]
TCTAGGGAGCAAAATGTTGAGGCTAATGATTTGGCTCAGGGGACATCAGGGTACAAGCCGATGGTAAGAGATATTGAAGTAGAGGTCGCTGCAATTACAG
CTGTAATTGCAGCGACCTCTACTTCAATATCTCTTACCATCGGCTTGTACCCTGATGTCCCCTGAGCCAAATCATTAGCCTCAACATTTTGCTCCCTAGA[A/T]
ACATGTTTCAAAATTACTAACCGAAAGCTATCATATCAATTTTCAAAATTACTATCCATCAATTTTCGGCACTTCTGGTTGTAGATTAGCAACGTATCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.30% | 13.00% | 1.38% | 52.24% | NA |
| All Indica | 2759 | 11.70% | 4.10% | 1.96% | 82.24% | NA |
| All Japonica | 1512 | 61.60% | 31.30% | 0.26% | 6.81% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.00% | 1.12% | NA |
| Indica I | 595 | 5.00% | 1.50% | 1.18% | 92.27% | NA |
| Indica II | 465 | 7.30% | 2.40% | 2.80% | 87.53% | NA |
| Indica III | 913 | 14.10% | 1.30% | 1.97% | 82.58% | NA |
| Indica Intermediate | 786 | 16.40% | 10.40% | 2.04% | 71.12% | NA |
| Temperate Japonica | 767 | 89.70% | 9.10% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 28.60% | 54.00% | 0.40% | 17.06% | NA |
| Japonica Intermediate | 241 | 41.10% | 54.80% | 0.83% | 3.32% | NA |
| VI/Aromatic | 96 | 22.90% | 9.40% | 3.12% | 64.58% | NA |
| Intermediate | 90 | 38.90% | 21.10% | 4.44% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400003186 | T -> DEL | N | N | silent_mutation | Average:13.091; most accessible tissue: Callus, score: 58.274 | N | N | N | N |
| vg0400003186 | T -> A | LOC_Os04g01006.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:13.091; most accessible tissue: Callus, score: 58.274 | N | N | N | N |
| vg0400003186 | T -> A | LOC_Os04g01008.1 | downstream_gene_variant ; 1765.0bp to feature; MODIFIER | silent_mutation | Average:13.091; most accessible tissue: Callus, score: 58.274 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400003186 | NA | 1.67E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400003186 | NA | 4.95E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400003186 | NA | 3.40E-06 | mr1388 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400003186 | NA | 1.07E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400003186 | 2.05E-06 | 6.41E-10 | mr1602 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400003186 | NA | 3.68E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400003186 | NA | 7.74E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400003186 | NA | 2.02E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400003186 | NA | 9.03E-08 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400003186 | NA | 8.49E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |