\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400003186:

Variant ID: vg0400003186 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3186
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGATACGTTGCTAATCTACAACCAGAAGTGCCGAAAATTGATGGATAGTAATTTTGAAAATTGATATGATAGCTTTCGGTTAGTAATTTTGAAACATGT[T/A]
TCTAGGGAGCAAAATGTTGAGGCTAATGATTTGGCTCAGGGGACATCAGGGTACAAGCCGATGGTAAGAGATATTGAAGTAGAGGTCGCTGCAATTACAG

Reverse complement sequence

CTGTAATTGCAGCGACCTCTACTTCAATATCTCTTACCATCGGCTTGTACCCTGATGTCCCCTGAGCCAAATCATTAGCCTCAACATTTTGCTCCCTAGA[A/T]
ACATGTTTCAAAATTACTAACCGAAAGCTATCATATCAATTTTCAAAATTACTATCCATCAATTTTCGGCACTTCTGGTTGTAGATTAGCAACGTATCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.30% 13.00% 1.38% 52.24% NA
All Indica  2759 11.70% 4.10% 1.96% 82.24% NA
All Japonica  1512 61.60% 31.30% 0.26% 6.81% NA
Aus  269 98.90% 0.00% 0.00% 1.12% NA
Indica I  595 5.00% 1.50% 1.18% 92.27% NA
Indica II  465 7.30% 2.40% 2.80% 87.53% NA
Indica III  913 14.10% 1.30% 1.97% 82.58% NA
Indica Intermediate  786 16.40% 10.40% 2.04% 71.12% NA
Temperate Japonica  767 89.70% 9.10% 0.00% 1.17% NA
Tropical Japonica  504 28.60% 54.00% 0.40% 17.06% NA
Japonica Intermediate  241 41.10% 54.80% 0.83% 3.32% NA
VI/Aromatic  96 22.90% 9.40% 3.12% 64.58% NA
Intermediate  90 38.90% 21.10% 4.44% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400003186 T -> DEL N N silent_mutation Average:13.091; most accessible tissue: Callus, score: 58.274 N N N N
vg0400003186 T -> A LOC_Os04g01006.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:13.091; most accessible tissue: Callus, score: 58.274 N N N N
vg0400003186 T -> A LOC_Os04g01008.1 downstream_gene_variant ; 1765.0bp to feature; MODIFIER silent_mutation Average:13.091; most accessible tissue: Callus, score: 58.274 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400003186 NA 1.67E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400003186 NA 4.95E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400003186 NA 3.40E-06 mr1388 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400003186 NA 1.07E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400003186 2.05E-06 6.41E-10 mr1602 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400003186 NA 3.68E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400003186 NA 7.74E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400003186 NA 2.02E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400003186 NA 9.03E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400003186 NA 8.49E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251