\
| Variant ID: vg0400002670 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2670 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAGAAATTGTGCTTGTGTTTATATTTTTCTTGCACAAAGTTGAGGCATTACTTATTGTCCAATGAATGCACTGTGATATGCAAAGCCGATGTGGTTAAAT[G/A]
TATGCTGGCGGCTCCAGTTTTGAAAGGAAGAATTGGAAAATGGATATATGCTTTGACAGAGTTTGATCTCGGGTATGAATCACCCAAGGCGATAAAGGGG
CCCCTTTATCGCCTTGGGTGATTCATACCCGAGATCAAACTCTGTCAAAGCATATATCCATTTTCCAATTCTTCCTTTCAAAACTGGAGCCGCCAGCATA[C/T]
ATTTAACCACATCGGCTTTGCATATCACAGTGCATTCATTGGACAATAAGTAATGCCTCAACTTTGTGCAAGAAAAATATAAACACAAGCACAATTTCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.90% | 17.00% | 0.80% | 56.35% | NA |
| All Indica | 2759 | 12.00% | 2.40% | 1.16% | 84.41% | NA |
| All Japonica | 1512 | 37.60% | 47.10% | 0.13% | 15.21% | NA |
| Aus | 269 | 97.00% | 1.50% | 0.37% | 1.12% | NA |
| Indica I | 595 | 1.80% | 4.00% | 1.85% | 92.27% | NA |
| Indica II | 465 | 5.60% | 1.70% | 1.29% | 91.40% | NA |
| Indica III | 913 | 12.90% | 1.20% | 0.55% | 85.32% | NA |
| Indica Intermediate | 786 | 22.50% | 2.90% | 1.27% | 73.28% | NA |
| Temperate Japonica | 767 | 11.70% | 71.70% | 0.26% | 16.30% | NA |
| Tropical Japonica | 504 | 65.70% | 16.30% | 0.00% | 18.06% | NA |
| Japonica Intermediate | 241 | 61.00% | 33.20% | 0.00% | 5.81% | NA |
| VI/Aromatic | 96 | 30.20% | 1.00% | 0.00% | 68.75% | NA |
| Intermediate | 90 | 36.70% | 21.10% | 3.33% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400002670 | G -> DEL | N | N | silent_mutation | Average:8.037; most accessible tissue: Callus, score: 35.121 | N | N | N | N |
| vg0400002670 | G -> A | LOC_Os04g01008.1 | downstream_gene_variant ; 2281.0bp to feature; MODIFIER | silent_mutation | Average:8.037; most accessible tissue: Callus, score: 35.121 | N | N | N | N |
| vg0400002670 | G -> A | LOC_Os04g01006.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.037; most accessible tissue: Callus, score: 35.121 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400002670 | NA | 1.37E-17 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0400002670 | NA | 5.76E-06 | mr1279 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 3.47E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 2.29E-10 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 4.19E-08 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 1.41E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 7.24E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 3.53E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 3.56E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 4.68E-07 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 1.95E-07 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 1.23E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 1.55E-07 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 2.92E-06 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 5.56E-08 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 9.07E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | NA | 7.59E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400002670 | 3.76E-06 | NA | mr1793_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |