\
| Variant ID: vg0336362784 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 36362784 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 286. )
TAAGCTCATCCCACCAGGTTGAGATGCGGGACGGAAGGGAATTGAGAGCTAGGGGCAAATTTTGCCACATACATACTGTAGTCCATACTTGTTTAACAAA[C/T]
GGACAATCCGCGAACAGATGATTGGTGTCTTCGAAGGCGGAGGTACACAAACAGTAAATCCAATTACAAGACCAATATCTTCTGAGCAAATTTTGAGCCA
TGGCTCAAAATTTGCTCAGAAGATATTGGTCTTGTAATTGGATTTACTGTTTGTGTACCTCCGCCTTCGAAGACACCAATCATCTGTTCGCGGATTGTCC[G/A]
TTTGTTAAACAAGTATGGACTACAGTATGTATGTGGCAAAATTTGCCCCTAGCTCTCAATTCCCTTCCGTCCCGCATCTCAACCTGGTGGGATGAGCTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 8.30% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 93.20% | 6.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.30% | 7.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.00% | 7.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0336362784 | C -> T | LOC_Os03g64320.1 | downstream_gene_variant ; 4175.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0336362784 | C -> T | LOC_Os03g64330.1 | downstream_gene_variant ; 1041.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0336362784 | C -> T | LOC_Os03g64340.1 | downstream_gene_variant ; 3584.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0336362784 | C -> T | LOC_Os03g64330-LOC_Os03g64340 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0336362784 | NA | 1.23E-18 | mr1166 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 3.84E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 9.93E-25 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 2.13E-26 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 1.81E-12 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 3.28E-23 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 6.26E-26 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 3.87E-12 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 6.53E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 1.57E-18 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 1.22E-11 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 8.10E-21 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336362784 | NA | 1.27E-11 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |