\
| Variant ID: vg0336337217 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 36337217 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAAACACATTTACACACACACTAGGGTCATTTAACTCTCCCTTTTATAGCGGCCCTTCTTGTGTGAAAAGAAAGAATAACATAAATGTAATAAAAAAAA[T/A]
ATATATCTCATTCCAATTCTAGCCACCACAATTTAGCTCAACCATCACTAAGTGGTCTGCCTCCTATTATATTGCCATCATCAAGCCTATTAATTAACAC
GTGTTAATTAATAGGCTTGATGATGGCAATATAATAGGAGGCAGACCACTTAGTGATGGTTGAGCTAAATTGTGGTGGCTAGAATTGGAATGAGATATAT[A/T]
TTTTTTTTATTACATTTATGTTATTCTTTCTTTTCACACAAGAAGGGCCGCTATAAAAGGGAGAGTTAAATGACCCTAGTGTGTGTGTAAATGTGTTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 6.20% | 1.10% | 0.00% | NA |
| All Indica | 2759 | 88.20% | 10.10% | 1.70% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 3.20% | 2.52% | 0.00% | NA |
| Indica II | 465 | 87.70% | 10.80% | 1.51% | 0.00% | NA |
| Indica III | 913 | 86.50% | 13.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 85.90% | 11.10% | 3.05% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0336337217 | T -> A | LOC_Os03g64290.1 | upstream_gene_variant ; 1754.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0336337217 | T -> A | LOC_Os03g64300.1 | upstream_gene_variant ; 2866.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0336337217 | T -> A | LOC_Os03g64290-LOC_Os03g64300 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0336337217 | NA | 8.14E-09 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | NA | 3.79E-07 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | NA | 4.46E-07 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | NA | 7.24E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | NA | 4.80E-12 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | NA | 3.44E-07 | mr1233 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | NA | 3.07E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | NA | 3.84E-06 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | 2.68E-06 | 6.26E-08 | mr1949 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | 8.74E-07 | NA | mr1233_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | 6.79E-07 | 5.87E-10 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | NA | 7.83E-07 | mr1404_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | 9.60E-06 | NA | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336337217 | NA | 1.01E-07 | mr1949_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |