\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0336337217:

Variant ID: vg0336337217 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 36337217
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAACACATTTACACACACACTAGGGTCATTTAACTCTCCCTTTTATAGCGGCCCTTCTTGTGTGAAAAGAAAGAATAACATAAATGTAATAAAAAAAA[T/A]
ATATATCTCATTCCAATTCTAGCCACCACAATTTAGCTCAACCATCACTAAGTGGTCTGCCTCCTATTATATTGCCATCATCAAGCCTATTAATTAACAC

Reverse complement sequence

GTGTTAATTAATAGGCTTGATGATGGCAATATAATAGGAGGCAGACCACTTAGTGATGGTTGAGCTAAATTGTGGTGGCTAGAATTGGAATGAGATATAT[A/T]
TTTTTTTTATTACATTTATGTTATTCTTTCTTTTCACACAAGAAGGGCCGCTATAAAAGGGAGAGTTAAATGACCCTAGTGTGTGTGTAAATGTGTTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 6.20% 1.10% 0.00% NA
All Indica  2759 88.20% 10.10% 1.70% 0.00% NA
All Japonica  1512 99.50% 0.30% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.30% 3.20% 2.52% 0.00% NA
Indica II  465 87.70% 10.80% 1.51% 0.00% NA
Indica III  913 86.50% 13.40% 0.11% 0.00% NA
Indica Intermediate  786 85.90% 11.10% 3.05% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0336337217 T -> A LOC_Os03g64290.1 upstream_gene_variant ; 1754.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0336337217 T -> A LOC_Os03g64300.1 upstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0336337217 T -> A LOC_Os03g64290-LOC_Os03g64300 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0336337217 NA 8.14E-09 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 NA 3.79E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 NA 4.46E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 NA 7.24E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 NA 4.80E-12 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 NA 3.44E-07 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 NA 3.07E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 NA 3.84E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 2.68E-06 6.26E-08 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 8.74E-07 NA mr1233_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 6.79E-07 5.87E-10 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 NA 7.83E-07 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 9.60E-06 NA mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336337217 NA 1.01E-07 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251