Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0336302808:

Variant ID: vg0336302808 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 36302808
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCCTCTAAAATTGCTCTAGTAAAATCAATTTCATAGGAATTTCAAAAAAAAAGGATAGGAAACAATCCTTTGTTTCAAAGAACTCTATAGAATTATTT[T/C]
CCATATGATAAAATGCTCTAAAATTCCTATGGTTTTTTTTCCTTTGATTCAAAGGAGGCCTTAGTTTACTGTCAATGATCTTATCAAAATACTATGCAAG

Reverse complement sequence

CTTGCATAGTATTTTGATAAGATCATTGACAGTAAACTAAGGCCTCCTTTGAATCAAAGGAAAAAAAACCATAGGAATTTTAGAGCATTTTATCATATGG[A/G]
AAATAATTCTATAGAGTTCTTTGAAACAAAGGATTGTTTCCTATCCTTTTTTTTTGAAATTCCTATGAAATTGATTTTACTAGAGCAATTTTAGAGGAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	44.30%	0.25%	0.30%	NA
All Indica	2759	83.40%	15.70%	0.40%	0.51%	NA
All Japonica	1512	0.80%	99.20%	0.00%	0.00%	NA
Aus	269	93.30%	6.70%	0.00%	0.00%	NA
Indica I	595	89.90%	8.20%	0.50%	1.34%	NA
Indica II	465	83.20%	15.90%	0.43%	0.43%	NA
Indica III	913	83.00%	16.80%	0.11%	0.11%	NA
Indica Intermediate	786	79.10%	19.80%	0.64%	0.38%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	1.60%	98.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	44.40%	54.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0336302808	T -> C	LOC_Os03g64260.1	upstream_gene_variant ; 401.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0336302808	T -> C	LOC_Os03g64269.1	upstream_gene_variant ; 3507.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0336302808	T -> C	LOC_Os03g64250.5	downstream_gene_variant ; 3361.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0336302808	T -> C	LOC_Os03g64250.6	downstream_gene_variant ; 3361.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0336302808	T -> C	LOC_Os03g64260-LOC_Os03g64269	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0336302808	T -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0336302808	NA	2.18E-10	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	NA	2.63E-07	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	NA	3.78E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	NA	5.89E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	1.13E-06	3.41E-33	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	1.69E-07	3.66E-12	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	7.95E-06	7.69E-13	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	3.07E-06	7.54E-08	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	NA	4.66E-06	mr1346	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	NA	8.63E-06	mr1587	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	NA	8.01E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	NA	2.33E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	5.40E-07	2.05E-13	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	7.74E-07	2.65E-07	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	3.59E-06	NA	mr1107_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	1.68E-06	NA	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	NA	2.95E-09	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	3.58E-09	8.93E-33	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	1.75E-10	1.47E-12	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	NA	5.17E-07	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	NA	1.74E-09	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	1.04E-06	5.74E-08	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	2.11E-08	1.70E-26	mr1949_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336302808	5.11E-09	5.53E-10	mr1949_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251