\
| Variant ID: vg0336260325 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 36260325 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 195. )
CGTTGAAAGAAATGGCATGAAAGCGGTGGTGTTGCTGCTAGCTACTCCCTACATCCTAAAAAACCAACATAGCACCGGATATAACACATCATAATACTAC[G/A]
AATCTGAACATATATTTATCTAGATTTATAATACTAAAATGTATCACATCCATTTATTTTTTATGGGACGGAGGGAGCACTTTCTCCGTCCCATGCATAT
ATATGCATGGGACGGAGAAAGTGCTCCCTCCGTCCCATAAAAAATAAATGGATGTGATACATTTTAGTATTATAAATCTAGATAAATATATGTTCAGATT[C/T]
GTAGTATTATGATGTGTTATATCCGGTGCTATGTTGGTTTTTTAGGATGTAGGGAGTAGCTAGCAGCAACACCACCGCTTTCATGCCATTTCTTTCAACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 9.10% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 86.60% | 13.00% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 77.00% | 22.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 91.80% | 7.20% | 1.01% | 0.00% | NA |
| Indica II | 465 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.80% | 12.60% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0336260325 | G -> A | LOC_Os03g64170.1 | upstream_gene_variant ; 826.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0336260325 | G -> A | LOC_Os03g64170.2 | upstream_gene_variant ; 3006.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0336260325 | G -> A | LOC_Os03g64170-LOC_Os03g64190 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0336260325 | 9.56E-06 | 1.76E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336260325 | NA | 2.60E-06 | mr1285 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336260325 | 3.78E-06 | 3.78E-06 | mr1501 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336260325 | NA | 2.59E-06 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336260325 | NA | 7.21E-06 | mr1982 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336260325 | NA | 2.80E-08 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |