Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0336243988:

Variant ID: vg0336243988 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 36243988
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTTCATGTGGATATATCAATTATACTATCAACTACTTCATCCGTTTCACCATGTAAGTCATTCTAGCATTTTCCACATTCATATTGATGTATCTAGATT[C/T]
ATTAACATCAATATAAATGTGGGAAATGCTAAAATGACTTATATTGTGAAATAGAGGGAGTAGAGACTAAGAAGATGGGTGAACTGAATGAAGAGCAAGA

Reverse complement sequence

TCTTGCTCTTCATTCAGTTCACCCATCTTCTTAGTCTCTACTCCCTCTATTTCACAATATAAGTCATTTTAGCATTTCCCACATTTATATTGATGTTAAT[G/A]
AATCTAGATACATCAATATGAATGTGGAAAATGCTAGAATGACTTACATGGTGAAACGGATGAAGTAGTTGATAGTATAATTGATATATCCACATGAACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	5.90%	0.02%	0.00%	NA
All Indica	2759	89.90%	10.00%	0.04%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.50%	3.50%	0.00%	0.00%	NA
Indica II	465	93.80%	6.00%	0.22%	0.00%	NA
Indica III	913	82.00%	18.00%	0.00%	0.00%	NA
Indica Intermediate	786	91.90%	8.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0336243988	C -> T	LOC_Os03g64130.1	upstream_gene_variant ; 3175.0bp to feature; MODIFIER	silent_mutation	Average:67.342; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0336243988	C -> T	LOC_Os03g64150.1	downstream_gene_variant ; 2098.0bp to feature; MODIFIER	silent_mutation	Average:67.342; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0336243988	C -> T	LOC_Os03g64140.1	intron_variant ; MODIFIER	silent_mutation	Average:67.342; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0336243988	2.56E-07	1.23E-08	mr1291	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988	1.62E-06	7.67E-07	mr1471	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988	4.09E-07	7.33E-08	mr1479	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988	NA	7.25E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988	NA	9.83E-07	mr1522	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988	2.85E-08	1.08E-08	mr1553	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988	2.40E-06	4.05E-07	mr1742	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988	NA	8.87E-06	mr1835	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988	2.48E-08	4.35E-09	mr1892	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988	2.63E-06	5.57E-07	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251