\
| Variant ID: vg0336243988 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 36243988 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTTCATGTGGATATATCAATTATACTATCAACTACTTCATCCGTTTCACCATGTAAGTCATTCTAGCATTTTCCACATTCATATTGATGTATCTAGATT[C/T]
ATTAACATCAATATAAATGTGGGAAATGCTAAAATGACTTATATTGTGAAATAGAGGGAGTAGAGACTAAGAAGATGGGTGAACTGAATGAAGAGCAAGA
TCTTGCTCTTCATTCAGTTCACCCATCTTCTTAGTCTCTACTCCCTCTATTTCACAATATAAGTCATTTTAGCATTTCCCACATTTATATTGATGTTAAT[G/A]
AATCTAGATACATCAATATGAATGTGGAAAATGCTAGAATGACTTACATGGTGAAACGGATGAAGTAGTTGATAGTATAATTGATATATCCACATGAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 5.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 89.90% | 10.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.80% | 6.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 82.00% | 18.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0336243988 | C -> T | LOC_Os03g64130.1 | upstream_gene_variant ; 3175.0bp to feature; MODIFIER | silent_mutation | Average:67.342; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0336243988 | C -> T | LOC_Os03g64150.1 | downstream_gene_variant ; 2098.0bp to feature; MODIFIER | silent_mutation | Average:67.342; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0336243988 | C -> T | LOC_Os03g64140.1 | intron_variant ; MODIFIER | silent_mutation | Average:67.342; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0336243988 | 2.56E-07 | 1.23E-08 | mr1291 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243988 | 1.62E-06 | 7.67E-07 | mr1471 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243988 | 4.09E-07 | 7.33E-08 | mr1479 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243988 | NA | 7.25E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243988 | NA | 9.83E-07 | mr1522 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243988 | 2.85E-08 | 1.08E-08 | mr1553 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243988 | 2.40E-06 | 4.05E-07 | mr1742 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243988 | NA | 8.87E-06 | mr1835 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243988 | 2.48E-08 | 4.35E-09 | mr1892 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336243988 | 2.63E-06 | 5.57E-07 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |