\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0336243988:

Variant ID: vg0336243988 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 36243988
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTCATGTGGATATATCAATTATACTATCAACTACTTCATCCGTTTCACCATGTAAGTCATTCTAGCATTTTCCACATTCATATTGATGTATCTAGATT[C/T]
ATTAACATCAATATAAATGTGGGAAATGCTAAAATGACTTATATTGTGAAATAGAGGGAGTAGAGACTAAGAAGATGGGTGAACTGAATGAAGAGCAAGA

Reverse complement sequence

TCTTGCTCTTCATTCAGTTCACCCATCTTCTTAGTCTCTACTCCCTCTATTTCACAATATAAGTCATTTTAGCATTTCCCACATTTATATTGATGTTAAT[G/A]
AATCTAGATACATCAATATGAATGTGGAAAATGCTAGAATGACTTACATGGTGAAACGGATGAAGTAGTTGATAGTATAATTGATATATCCACATGAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 5.90% 0.02% 0.00% NA
All Indica  2759 89.90% 10.00% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.50% 3.50% 0.00% 0.00% NA
Indica II  465 93.80% 6.00% 0.22% 0.00% NA
Indica III  913 82.00% 18.00% 0.00% 0.00% NA
Indica Intermediate  786 91.90% 8.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0336243988 C -> T LOC_Os03g64130.1 upstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:67.342; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0336243988 C -> T LOC_Os03g64150.1 downstream_gene_variant ; 2098.0bp to feature; MODIFIER silent_mutation Average:67.342; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0336243988 C -> T LOC_Os03g64140.1 intron_variant ; MODIFIER silent_mutation Average:67.342; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0336243988 2.56E-07 1.23E-08 mr1291 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988 1.62E-06 7.67E-07 mr1471 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988 4.09E-07 7.33E-08 mr1479 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988 NA 7.25E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988 NA 9.83E-07 mr1522 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988 2.85E-08 1.08E-08 mr1553 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988 2.40E-06 4.05E-07 mr1742 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988 NA 8.87E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988 2.48E-08 4.35E-09 mr1892 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336243988 2.63E-06 5.57E-07 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251