\
| Variant ID: vg0336117363 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 36117363 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCTTGCACGTAAAGTTTATGTTTTTATGTATAGATTACAGAACTCAGATCTGTACTGGGTCAAACTTCTGTTTATCCCTAAGGACTGCCAGGGGGTTCAG[C/A]
TTATACAAAAGCTAATATAAAATTTCTTTTCTGAAAGTATCTCATTTCCAAAATTTGTAAAGATAAATTGCTGTAAACATGTTTATAAGTTTAATATTAA
TTAATATTAAACTTATAAACATGTTTACAGCAATTTATCTTTACAAATTTTGGAAATGAGATACTTTCAGAAAAGAAATTTTATATTAGCTTTTGTATAA[G/T]
CTGAACCCCCTGGCAGTCCTTAGGGATAAACAGAAGTTTGACCCAGTACAGATCTGAGTTCTGTAATCTATACATAAAAACATAAACTTTACGTGCAAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 4.00% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 92.90% | 6.80% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.80% | 4.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 86.20% | 13.40% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 94.30% | 5.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0336117363 | C -> A | LOC_Os03g63930.1 | downstream_gene_variant ; 2255.0bp to feature; MODIFIER | silent_mutation | Average:39.746; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0336117363 | C -> A | LOC_Os03g63930.2 | downstream_gene_variant ; 2808.0bp to feature; MODIFIER | silent_mutation | Average:39.746; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0336117363 | C -> A | LOC_Os03g63920.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.746; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0336117363 | 2.78E-06 | 2.74E-08 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336117363 | 4.76E-06 | 1.74E-07 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336117363 | NA | 9.23E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336117363 | NA | 6.04E-06 | mr1522 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336117363 | NA | 5.55E-06 | mr1543 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336117363 | 3.19E-06 | 3.21E-07 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336117363 | NA | 1.32E-06 | mr1742 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336117363 | 4.08E-07 | 1.42E-08 | mr1892 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336117363 | 2.00E-06 | 7.94E-08 | mr1975 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |