\
| Variant ID: vg0336030581 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 36030581 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 51. )
TGAAATCGTCTAGACATGTGAAAAGACGATTGAAGTCTGTCAGTAAATTGAGAAACTCTGGAGTTATAGCGTTGGATTACATCCAAACAGCTAGAAACCT[A/G]
GCAGATCCTTTCACGAAGGGACTATCACGAAATATGATAGATAATGCATCGAAGGAGATGGGTTTGAGACCCATGTGAGTTATACTATGGTGGTAACCCA
TGGGTTACCACCATAGTATAACTCACATGGGTCTCAAACCCATCTCCTTCGATGCATTATCTATCATATTTCGTGATAGTCCCTTCGTGAAAGGATCTGC[T/C]
AGGTTTCTAGCTGTTTGGATGTAATCCAACGCTATAACTCCAGAGTTTCTCAATTTACTGACAGACTTCAATCGTCTTTTCACATGTCTAGACGATTTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 15.80% | 1.27% | 31.36% | NA |
| All Indica | 2759 | 48.40% | 1.60% | 1.52% | 48.57% | NA |
| All Japonica | 1512 | 54.10% | 45.60% | 0.00% | 0.33% | NA |
| Aus | 269 | 51.70% | 0.70% | 5.58% | 42.01% | NA |
| Indica I | 595 | 42.20% | 2.40% | 0.34% | 55.13% | NA |
| Indica II | 465 | 61.90% | 2.20% | 0.86% | 35.05% | NA |
| Indica III | 913 | 42.10% | 0.50% | 2.08% | 55.31% | NA |
| Indica Intermediate | 786 | 52.30% | 1.80% | 2.16% | 43.77% | NA |
| Temperate Japonica | 767 | 22.40% | 77.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 5.20% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 57.80% | 14.40% | 3.33% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0336030581 | A -> DEL | N | N | silent_mutation | Average:10.082; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0336030581 | A -> G | LOC_Os03g63800.1 | upstream_gene_variant ; 1826.0bp to feature; MODIFIER | silent_mutation | Average:10.082; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0336030581 | A -> G | LOC_Os03g63800-LOC_Os03g63810 | intergenic_region ; MODIFIER | silent_mutation | Average:10.082; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0336030581 | NA | 1.11E-07 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | 2.13E-06 | 2.92E-06 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | 5.70E-06 | NA | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 3.74E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 7.61E-06 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | 4.73E-07 | 6.13E-07 | mr1742 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 5.39E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 4.89E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 1.60E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | 3.89E-06 | 4.41E-07 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 1.87E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 5.84E-06 | mr1663_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 1.08E-06 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 1.85E-07 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 7.45E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 8.64E-08 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0336030581 | NA | 3.57E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |