\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0336030581:

Variant ID: vg0336030581 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 36030581
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAATCGTCTAGACATGTGAAAAGACGATTGAAGTCTGTCAGTAAATTGAGAAACTCTGGAGTTATAGCGTTGGATTACATCCAAACAGCTAGAAACCT[A/G]
GCAGATCCTTTCACGAAGGGACTATCACGAAATATGATAGATAATGCATCGAAGGAGATGGGTTTGAGACCCATGTGAGTTATACTATGGTGGTAACCCA

Reverse complement sequence

TGGGTTACCACCATAGTATAACTCACATGGGTCTCAAACCCATCTCCTTCGATGCATTATCTATCATATTTCGTGATAGTCCCTTCGTGAAAGGATCTGC[T/C]
AGGTTTCTAGCTGTTTGGATGTAATCCAACGCTATAACTCCAGAGTTTCTCAATTTACTGACAGACTTCAATCGTCTTTTCACATGTCTAGACGATTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 15.80% 1.27% 31.36% NA
All Indica  2759 48.40% 1.60% 1.52% 48.57% NA
All Japonica  1512 54.10% 45.60% 0.00% 0.33% NA
Aus  269 51.70% 0.70% 5.58% 42.01% NA
Indica I  595 42.20% 2.40% 0.34% 55.13% NA
Indica II  465 61.90% 2.20% 0.86% 35.05% NA
Indica III  913 42.10% 0.50% 2.08% 55.31% NA
Indica Intermediate  786 52.30% 1.80% 2.16% 43.77% NA
Temperate Japonica  767 22.40% 77.60% 0.00% 0.00% NA
Tropical Japonica  504 93.80% 5.20% 0.00% 0.99% NA
Japonica Intermediate  241 71.80% 28.20% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 57.80% 14.40% 3.33% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0336030581 A -> DEL N N silent_mutation Average:10.082; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0336030581 A -> G LOC_Os03g63800.1 upstream_gene_variant ; 1826.0bp to feature; MODIFIER silent_mutation Average:10.082; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0336030581 A -> G LOC_Os03g63800-LOC_Os03g63810 intergenic_region ; MODIFIER silent_mutation Average:10.082; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0336030581 NA 1.11E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 2.13E-06 2.92E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 5.70E-06 NA mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 3.74E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 7.61E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 4.73E-07 6.13E-07 mr1742 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 5.39E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 4.89E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 1.60E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 3.89E-06 4.41E-07 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 1.87E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 5.84E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 1.08E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 1.85E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 7.45E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 8.64E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0336030581 NA 3.57E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251