Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335906768:

Variant ID: vg0335906768 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35906768
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCAACTCTCCTGATCTCTCTGGCTCTGCCTCTCTCTATATAGTGTCACAGTGTATTCATGCAGAAATTGATCCAAACCAAAACCAAAAGTGAAAAAA[G/A]
AAAGTACCAAGAAGAATATAATCAACACAAGAGTACAGTAGTGTAGCAATGGCGGCGGCGGCGGCCGGCGGCAAGATCAAGACGGTGGTGGTGCTGGTGA

Reverse complement sequence

TCACCAGCACCACCACCGTCTTGATCTTGCCGCCGGCCGCCGCCGCCGCCATTGCTACACTACTGTACTCTTGTGTTGATTATATTCTTCTTGGTACTTT[C/T]
TTTTTTCACTTTTGGTTTTGGTTTGGATCAATTTCTGCATGAATACACTGTGACACTATATAGAGAGAGGCAGAGCCAGAGAGATCAGGAGAGTTGAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 30.70% 0.19% 0.21% NA
All Indica  2759 53.70% 45.60% 0.29% 0.36% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 48.30% 51.70% 0.00% 0.00% NA
Indica I  595 29.90% 69.10% 0.17% 0.84% NA
Indica II  465 72.00% 27.30% 0.00% 0.65% NA
Indica III  913 57.40% 42.60% 0.00% 0.00% NA
Indica Intermediate  786 56.60% 42.20% 0.89% 0.25% NA
Temperate Japonica  767 96.20% 3.80% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335906768 G -> A LOC_Os03g63580.1 5_prime_UTR_variant ; 49.0bp to feature; MODIFIER silent_mutation Average:82.313; most accessible tissue: Zhenshan97 flower, score: 94.897 N N N N
vg0335906768 G -> A LOC_Os03g63560.1 upstream_gene_variant ; 3702.0bp to feature; MODIFIER silent_mutation Average:82.313; most accessible tissue: Zhenshan97 flower, score: 94.897 N N N N
vg0335906768 G -> A LOC_Os03g63554.1 downstream_gene_variant ; 4969.0bp to feature; MODIFIER silent_mutation Average:82.313; most accessible tissue: Zhenshan97 flower, score: 94.897 N N N N
vg0335906768 G -> A LOC_Os03g63570.1 downstream_gene_variant ; 1145.0bp to feature; MODIFIER silent_mutation Average:82.313; most accessible tissue: Zhenshan97 flower, score: 94.897 N N N N
vg0335906768 G -> A LOC_Os03g63590.1 downstream_gene_variant ; 1863.0bp to feature; MODIFIER silent_mutation Average:82.313; most accessible tissue: Zhenshan97 flower, score: 94.897 N N N N
vg0335906768 G -> DEL N N silent_mutation Average:82.313; most accessible tissue: Zhenshan97 flower, score: 94.897 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335906768 G A 0.0 -0.03 -0.04 0.01 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335906768 4.58E-06 2.00E-17 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 2.18E-06 7.79E-20 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 4.13E-08 2.56E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 NA 1.72E-19 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 NA 4.94E-17 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 4.98E-06 7.17E-21 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 1.65E-08 6.24E-28 mr1123 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 NA 1.67E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 NA 5.93E-16 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 1.48E-09 4.07E-24 mr1242 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 4.94E-09 2.21E-21 mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 NA 1.57E-21 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 2.02E-07 NA mr1917 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 9.84E-06 1.69E-18 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 NA 4.89E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 9.95E-06 4.68E-18 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 NA 8.10E-18 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 2.73E-06 4.28E-23 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 NA 5.37E-18 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 9.66E-06 7.24E-15 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335906768 NA 1.09E-14 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251