\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335804756:

Variant ID: vg0335804756 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35804756
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.07, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CTACTAGTCGGAATATATTCTGAATACAAATAAATTTGTATTTGAATCTCAGTCAGAATATATCTGTATTTGTATATTTGTATACAAATATATTCCAAAT[T/G]
TGTATTTAAATCTACCAGTCGGAATATATTTGTATTCAAATTTGGTAGATTTCGAAAAAATTTCATAAACTAATATTTGAATATAAATATCATGAGTTTA

Reverse complement sequence

TAAACTCATGATATTTATATTCAAATATTAGTTTATGAAATTTTTTCGAAATCTACCAAATTTGAATACAAATATATTCCGACTGGTAGATTTAAATACA[A/C]
ATTTGGAATATATTTGTATACAAATATACAAATACAGATATATTCTGACTGAGATTCAAATACAAATTTATTTGTATTCAGAATATATTCCGACTAGTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 43.60% 0.63% 1.99% NA
All Indica  2759 51.60% 44.60% 0.80% 2.97% NA
All Japonica  1512 54.30% 45.40% 0.33% 0.00% NA
Aus  269 95.20% 0.40% 0.00% 4.46% NA
Indica I  595 73.30% 21.50% 1.01% 4.20% NA
Indica II  465 35.90% 64.10% 0.00% 0.00% NA
Indica III  913 44.50% 51.40% 1.20% 2.96% NA
Indica Intermediate  786 52.80% 42.70% 0.64% 3.82% NA
Temperate Japonica  767 89.80% 9.50% 0.65% 0.00% NA
Tropical Japonica  504 9.10% 90.90% 0.00% 0.00% NA
Japonica Intermediate  241 35.70% 64.30% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 94.80% 1.04% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335804756 T -> DEL N N silent_mutation Average:38.311; most accessible tissue: Callus, score: 87.337 N N N N
vg0335804756 T -> G LOC_Os03g63350.1 downstream_gene_variant ; 4381.0bp to feature; MODIFIER silent_mutation Average:38.311; most accessible tissue: Callus, score: 87.337 N N N N
vg0335804756 T -> G LOC_Os03g63360.1 downstream_gene_variant ; 1283.0bp to feature; MODIFIER silent_mutation Average:38.311; most accessible tissue: Callus, score: 87.337 N N N N
vg0335804756 T -> G LOC_Os03g63350-LOC_Os03g63360 intergenic_region ; MODIFIER silent_mutation Average:38.311; most accessible tissue: Callus, score: 87.337 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335804756 NA 2.49E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 4.11E-06 NA mr1183 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 1.10E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 5.17E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 1.38E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 1.05E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 5.30E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 7.87E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 3.47E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 6.21E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 4.66E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 1.90E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 3.35E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804756 NA 4.41E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251