\
| Variant ID: vg0335804756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35804756 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.07, others allele: 0.00, population size: 108. )
CTACTAGTCGGAATATATTCTGAATACAAATAAATTTGTATTTGAATCTCAGTCAGAATATATCTGTATTTGTATATTTGTATACAAATATATTCCAAAT[T/G]
TGTATTTAAATCTACCAGTCGGAATATATTTGTATTCAAATTTGGTAGATTTCGAAAAAATTTCATAAACTAATATTTGAATATAAATATCATGAGTTTA
TAAACTCATGATATTTATATTCAAATATTAGTTTATGAAATTTTTTCGAAATCTACCAAATTTGAATACAAATATATTCCGACTGGTAGATTTAAATACA[A/C]
ATTTGGAATATATTTGTATACAAATATACAAATACAGATATATTCTGACTGAGATTCAAATACAAATTTATTTGTATTCAGAATATATTCCGACTAGTAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 43.60% | 0.63% | 1.99% | NA |
| All Indica | 2759 | 51.60% | 44.60% | 0.80% | 2.97% | NA |
| All Japonica | 1512 | 54.30% | 45.40% | 0.33% | 0.00% | NA |
| Aus | 269 | 95.20% | 0.40% | 0.00% | 4.46% | NA |
| Indica I | 595 | 73.30% | 21.50% | 1.01% | 4.20% | NA |
| Indica II | 465 | 35.90% | 64.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 44.50% | 51.40% | 1.20% | 2.96% | NA |
| Indica Intermediate | 786 | 52.80% | 42.70% | 0.64% | 3.82% | NA |
| Temperate Japonica | 767 | 89.80% | 9.50% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 9.10% | 90.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.70% | 64.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 94.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 55.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335804756 | T -> DEL | N | N | silent_mutation | Average:38.311; most accessible tissue: Callus, score: 87.337 | N | N | N | N |
| vg0335804756 | T -> G | LOC_Os03g63350.1 | downstream_gene_variant ; 4381.0bp to feature; MODIFIER | silent_mutation | Average:38.311; most accessible tissue: Callus, score: 87.337 | N | N | N | N |
| vg0335804756 | T -> G | LOC_Os03g63360.1 | downstream_gene_variant ; 1283.0bp to feature; MODIFIER | silent_mutation | Average:38.311; most accessible tissue: Callus, score: 87.337 | N | N | N | N |
| vg0335804756 | T -> G | LOC_Os03g63350-LOC_Os03g63360 | intergenic_region ; MODIFIER | silent_mutation | Average:38.311; most accessible tissue: Callus, score: 87.337 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335804756 | NA | 2.49E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | 4.11E-06 | NA | mr1183 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 1.10E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 5.17E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 1.38E-09 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 1.05E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 5.30E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 7.87E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 3.47E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 6.21E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 4.66E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 1.90E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 3.35E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335804756 | NA | 4.41E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |