Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335804306:

Variant ID: vg0335804306 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35804306
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATTAATGGCAAAATCTCGTTTAATTTATCTGCCAATCATATTTTGGGGAAAAAAGAGCAAAGAAACAAACATAGATATAATGTAAAACCAATCGATGA[C/T]
TTGCTGTACCTACGGCGAGCGAGCGAGCGATCGATCGAACAAACCAATAAAATTATTGGGAGCTGGGAGAAGAAATTGCGGCGCGTCGAGGCGAGGCGAG

Reverse complement sequence

CTCGCCTCGCCTCGACGCGCCGCAATTTCTTCTCCCAGCTCCCAATAATTTTATTGGTTTGTTCGATCGATCGCTCGCTCGCTCGCCGTAGGTACAGCAA[G/A]
TCATCGATTGGTTTTACATTATATCTATGTTTGTTTCTTTGCTCTTTTTTCCCCAAAATATGATTGGCAGATAAATTAAACGAGATTTTGCCATTAATTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	7.20%	0.23%	2.09%	NA
All Indica	2759	94.40%	2.10%	0.40%	3.15%	NA
All Japonica	1512	98.70%	1.30%	0.00%	0.00%	NA
Aus	269	0.70%	94.80%	0.00%	4.46%	NA
Indica I	595	94.50%	1.00%	0.34%	4.20%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	95.00%	0.90%	0.55%	3.61%	NA
Indica Intermediate	786	90.60%	5.20%	0.51%	3.69%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335804306	C -> T	LOC_Os03g63350.1	downstream_gene_variant ; 3931.0bp to feature; MODIFIER	silent_mutation	Average:53.957; most accessible tissue: Callus, score: 89.577	N	N	N	N
vg0335804306	C -> T	LOC_Os03g63360.1	downstream_gene_variant ; 1733.0bp to feature; MODIFIER	silent_mutation	Average:53.957; most accessible tissue: Callus, score: 89.577	N	N	N	N
vg0335804306	C -> T	LOC_Os03g63350-LOC_Os03g63360	intergenic_region ; MODIFIER	silent_mutation	Average:53.957; most accessible tissue: Callus, score: 89.577	N	N	N	N
vg0335804306	C -> DEL	N	N	silent_mutation	Average:53.957; most accessible tissue: Callus, score: 89.577	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335804306	2.58E-06	2.58E-06	mr1273	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804306	NA	1.86E-25	mr1868	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335804306	NA	1.29E-12	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251