\
| Variant ID: vg0335792519 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35792519 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATTTGATTTATAGAGATTGTACATGGTTATTGCTAGTGCAATAGCACAAACTAAGAAATTTCTTTCCTTATCAATAGAGCTGATCACTTTCCTTTAAAC[T/C]
GCCAACTGAAACCTGCTAAGAAAAAATGGCGTGCGATCAGTTTATTTATAAAATATACATGAGTAATCCACTAAAACATAGTTCTTTTCATTTTTTCTTG
CAAGAAAAAATGAAAAGAACTATGTTTTAGTGGATTACTCATGTATATTTTATAAATAAACTGATCGCACGCCATTTTTTCTTAGCAGGTTTCAGTTGGC[A/G]
GTTTAAAGGAAAGTGATCAGCTCTATTGATAAGGAAAGAAATTTCTTAGTTTGTGCTATTGCACTAGCAATAACCATGTACAATCTCTATAAATCAAATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.20% | 49.70% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 27.20% | 72.60% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 97.80% | 2.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 4.40% | 95.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 17.20% | 82.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 46.80% | 53.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 27.70% | 72.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335792519 | T -> C | LOC_Os03g63330.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.673; most accessible tissue: Callus, score: 62.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335792519 | 1.89E-06 | 2.04E-06 | mr1114 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335792519 | NA | 2.40E-06 | mr1961 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335792519 | NA | 1.73E-06 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335792519 | 6.91E-06 | 8.77E-07 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335792519 | NA | 9.58E-08 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335792519 | NA | 3.77E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |