RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0335792519:

Variant ID: vg0335792519 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35792519
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATTTGATTTATAGAGATTGTACATGGTTATTGCTAGTGCAATAGCACAAACTAAGAAATTTCTTTCCTTATCAATAGAGCTGATCACTTTCCTTTAAAC[T/C]
GCCAACTGAAACCTGCTAAGAAAAAATGGCGTGCGATCAGTTTATTTATAAAATATACATGAGTAATCCACTAAAACATAGTTCTTTTCATTTTTTCTTG

Reverse complement sequence

CAAGAAAAAATGAAAAGAACTATGTTTTAGTGGATTACTCATGTATATTTTATAAATAAACTGATCGCACGCCATTTTTTCTTAGCAGGTTTCAGTTGGC[A/G]
GTTTAAAGGAAAGTGATCAGCTCTATTGATAAGGAAAGAAATTTCTTAGTTTGTGCTATTGCACTAGCAATAACCATGTACAATCTCTATAAATCAAATG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.20%	49.70%	0.15%	0.00%	NA
All Indica	2759	27.20%	72.60%	0.18%	0.00%	NA
All Japonica	1512	97.80%	2.10%	0.07%	0.00%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	4.40%	95.30%	0.34%	0.00%	NA
Indica II	465	17.20%	82.60%	0.22%	0.00%	NA
Indica III	913	46.80%	53.10%	0.11%	0.00%	NA
Indica Intermediate	786	27.70%	72.10%	0.13%	0.00%	NA
Temperate Japonica	767	99.10%	0.80%	0.13%	0.00%	NA
Tropical Japonica	504	95.40%	4.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	53.30%	45.60%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335792519	T -> C	LOC_Os03g63330.1	intron_variant ; MODIFIER	silent_mutation	Average:33.673; most accessible tissue: Callus, score: 62.839	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335792519	1.89E-06	2.04E-06	mr1114	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335792519	NA	2.40E-06	mr1961	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335792519	NA	1.73E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335792519	6.91E-06	8.77E-07	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335792519	NA	9.58E-08	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335792519	NA	3.77E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0335792519:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact