\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335763672:

Variant ID: vg0335763672 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35763672
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAGACTAAGCTTAAGTGTCAGGATCGGGTTAGGAGCTAGCACGGAGAAATTAATCAACCCTAATTCAAATGCCATATACTGGTAGAGAAACCATCTTT[A/G]
GTCGGTCGACCCATATCCACAATAGTCCCGGTTCCATTAAAAACCGGGACTAAAAATGATTTTTAGTCCCGGTTAATAAGAGGAAGATCTTTAGTCCCGG

Reverse complement sequence

CCGGGACTAAAGATCTTCCTCTTATTAACCGGGACTAAAAATCATTTTTAGTCCCGGTTTTTAATGGAACCGGGACTATTGTGGATATGGGTCGACCGAC[T/C]
AAAGATGGTTTCTCTACCAGTATATGGCATTTGAATTAGGGTTGATTAATTTCTCCGTGCTAGCTCCTAACCCGATCCTGACACTTAAGCTTAGTCTAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 17.40% 1.23% 43.69% NA
All Indica  2759 35.00% 1.10% 1.56% 62.34% NA
All Japonica  1512 45.00% 51.30% 0.07% 3.64% NA
Aus  269 0.40% 0.00% 4.09% 95.54% NA
Indica I  595 20.80% 0.80% 1.34% 76.97% NA
Indica II  465 55.50% 3.00% 1.08% 40.43% NA
Indica III  913 39.00% 0.50% 0.88% 59.58% NA
Indica Intermediate  786 28.90% 0.90% 2.80% 67.43% NA
Temperate Japonica  767 9.90% 86.00% 0.13% 3.91% NA
Tropical Japonica  504 89.50% 6.00% 0.00% 4.56% NA
Japonica Intermediate  241 63.50% 35.70% 0.00% 0.83% NA
VI/Aromatic  96 93.80% 3.10% 1.04% 2.08% NA
Intermediate  90 48.90% 14.40% 2.22% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335763672 A -> DEL N N silent_mutation Average:40.127; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg0335763672 A -> G LOC_Os03g63280.1 upstream_gene_variant ; 3258.0bp to feature; MODIFIER silent_mutation Average:40.127; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg0335763672 A -> G LOC_Os03g63270-LOC_Os03g63280 intergenic_region ; MODIFIER silent_mutation Average:40.127; most accessible tissue: Minghui63 root, score: 65.279 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335763672 NA 1.75E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672 1.18E-06 1.78E-09 mr1602 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672 NA 7.17E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672 NA 3.20E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672 NA 4.24E-06 mr1947 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672 NA 1.94E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672 NA 7.31E-09 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672 NA 8.10E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672 NA 6.70E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335763672 NA 6.91E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251