\
| Variant ID: vg0335763672 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35763672 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 55. )
CTTAGACTAAGCTTAAGTGTCAGGATCGGGTTAGGAGCTAGCACGGAGAAATTAATCAACCCTAATTCAAATGCCATATACTGGTAGAGAAACCATCTTT[A/G]
GTCGGTCGACCCATATCCACAATAGTCCCGGTTCCATTAAAAACCGGGACTAAAAATGATTTTTAGTCCCGGTTAATAAGAGGAAGATCTTTAGTCCCGG
CCGGGACTAAAGATCTTCCTCTTATTAACCGGGACTAAAAATCATTTTTAGTCCCGGTTTTTAATGGAACCGGGACTATTGTGGATATGGGTCGACCGAC[T/C]
AAAGATGGTTTCTCTACCAGTATATGGCATTTGAATTAGGGTTGATTAATTTCTCCGTGCTAGCTCCTAACCCGATCCTGACACTTAAGCTTAGTCTAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.70% | 17.40% | 1.23% | 43.69% | NA |
| All Indica | 2759 | 35.00% | 1.10% | 1.56% | 62.34% | NA |
| All Japonica | 1512 | 45.00% | 51.30% | 0.07% | 3.64% | NA |
| Aus | 269 | 0.40% | 0.00% | 4.09% | 95.54% | NA |
| Indica I | 595 | 20.80% | 0.80% | 1.34% | 76.97% | NA |
| Indica II | 465 | 55.50% | 3.00% | 1.08% | 40.43% | NA |
| Indica III | 913 | 39.00% | 0.50% | 0.88% | 59.58% | NA |
| Indica Intermediate | 786 | 28.90% | 0.90% | 2.80% | 67.43% | NA |
| Temperate Japonica | 767 | 9.90% | 86.00% | 0.13% | 3.91% | NA |
| Tropical Japonica | 504 | 89.50% | 6.00% | 0.00% | 4.56% | NA |
| Japonica Intermediate | 241 | 63.50% | 35.70% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 93.80% | 3.10% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 48.90% | 14.40% | 2.22% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335763672 | A -> DEL | N | N | silent_mutation | Average:40.127; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg0335763672 | A -> G | LOC_Os03g63280.1 | upstream_gene_variant ; 3258.0bp to feature; MODIFIER | silent_mutation | Average:40.127; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg0335763672 | A -> G | LOC_Os03g63270-LOC_Os03g63280 | intergenic_region ; MODIFIER | silent_mutation | Average:40.127; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335763672 | NA | 1.75E-09 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335763672 | 1.18E-06 | 1.78E-09 | mr1602 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335763672 | NA | 7.17E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335763672 | NA | 3.20E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335763672 | NA | 4.24E-06 | mr1947 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335763672 | NA | 1.94E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335763672 | NA | 7.31E-09 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335763672 | NA | 8.10E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335763672 | NA | 6.70E-06 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335763672 | NA | 6.91E-07 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |