Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0335759426:

Variant ID: vg0335759426 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35759426
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTGAAATTCAGAATTAAAAATAAGCAATATTGAAATAAGTTTTCATATAAGAACCGAATACGAGATTAATCAAAATTCAAAATAAAATAAAATAAAAAC[C/A]
AAAATTAGAAAAGAAAAGGAGAGTCCAAGTAGGAATACAATTTAAAAATAGCTGAAATTCGGAATTAAAAATAAGAAATATTAAAAGAAGAATCCATATA

Reverse complement sequence

TATATGGATTCTTCTTTTAATATTTCTTATTTTTAATTCCGAATTTCAGCTATTTTTAAATTGTATTCCTACTTGGACTCTCCTTTTCTTTTCTAATTTT[G/T]
GTTTTTATTTTATTTTATTTTGAATTTTGATTAATCTCGTATTCGGTTCTTATATGAAAACTTATTTCAATATTGCTTATTTTTAATTCTGAATTTCAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.90%	4.60%	0.06%	1.46%	NA
All Indica	2759	97.50%	1.10%	0.00%	1.41%	NA
All Japonica	1512	96.80%	1.20%	0.07%	1.98%	NA
Aus	269	39.00%	60.20%	0.74%	0.00%	NA
Indica I	595	99.20%	0.70%	0.00%	0.17%	NA
Indica II	465	93.80%	0.00%	0.00%	6.24%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	3.10%	0.00%	1.15%	NA
Temperate Japonica	767	96.10%	0.10%	0.00%	3.78%	NA
Tropical Japonica	504	96.40%	3.40%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335759426	C -> A	LOC_Os03g63270.1	downstream_gene_variant ; 1371.0bp to feature; MODIFIER	silent_mutation	Average:25.94; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0335759426	C -> A	LOC_Os03g63270-LOC_Os03g63280	intergenic_region ; MODIFIER	silent_mutation	Average:25.94; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0335759426	C -> DEL	N	N	silent_mutation	Average:25.94; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335759426	NA	3.48E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426	NA	2.48E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426	NA	1.83E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426	NA	7.89E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426	2.47E-08	NA	mr1249	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426	NA	5.11E-07	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426	NA	9.16E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426	9.26E-07	NA	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426	1.95E-06	NA	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251