| Variant ID: vg0335759426 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35759426 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCTGAAATTCAGAATTAAAAATAAGCAATATTGAAATAAGTTTTCATATAAGAACCGAATACGAGATTAATCAAAATTCAAAATAAAATAAAATAAAAAC[C/A]
AAAATTAGAAAAGAAAAGGAGAGTCCAAGTAGGAATACAATTTAAAAATAGCTGAAATTCGGAATTAAAAATAAGAAATATTAAAAGAAGAATCCATATA
TATATGGATTCTTCTTTTAATATTTCTTATTTTTAATTCCGAATTTCAGCTATTTTTAAATTGTATTCCTACTTGGACTCTCCTTTTCTTTTCTAATTTT[G/T]
GTTTTTATTTTATTTTATTTTGAATTTTGATTAATCTCGTATTCGGTTCTTATATGAAAACTTATTTCAATATTGCTTATTTTTAATTCTGAATTTCAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 4.60% | 0.06% | 1.46% | NA |
| All Indica | 2759 | 97.50% | 1.10% | 0.00% | 1.41% | NA |
| All Japonica | 1512 | 96.80% | 1.20% | 0.07% | 1.98% | NA |
| Aus | 269 | 39.00% | 60.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.00% | 0.17% | NA |
| Indica II | 465 | 93.80% | 0.00% | 0.00% | 6.24% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 3.10% | 0.00% | 1.15% | NA |
| Temperate Japonica | 767 | 96.10% | 0.10% | 0.00% | 3.78% | NA |
| Tropical Japonica | 504 | 96.40% | 3.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335759426 | C -> A | LOC_Os03g63270.1 | downstream_gene_variant ; 1371.0bp to feature; MODIFIER | silent_mutation | Average:25.94; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0335759426 | C -> A | LOC_Os03g63270-LOC_Os03g63280 | intergenic_region ; MODIFIER | silent_mutation | Average:25.94; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0335759426 | C -> DEL | N | N | silent_mutation | Average:25.94; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335759426 | NA | 3.48E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335759426 | NA | 2.48E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335759426 | NA | 1.83E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335759426 | NA | 7.89E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335759426 | 2.47E-08 | NA | mr1249 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335759426 | NA | 5.11E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335759426 | NA | 9.16E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335759426 | 9.26E-07 | NA | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335759426 | 1.95E-06 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |