\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335759426:

Variant ID: vg0335759426 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35759426
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGAAATTCAGAATTAAAAATAAGCAATATTGAAATAAGTTTTCATATAAGAACCGAATACGAGATTAATCAAAATTCAAAATAAAATAAAATAAAAAC[C/A]
AAAATTAGAAAAGAAAAGGAGAGTCCAAGTAGGAATACAATTTAAAAATAGCTGAAATTCGGAATTAAAAATAAGAAATATTAAAAGAAGAATCCATATA

Reverse complement sequence

TATATGGATTCTTCTTTTAATATTTCTTATTTTTAATTCCGAATTTCAGCTATTTTTAAATTGTATTCCTACTTGGACTCTCCTTTTCTTTTCTAATTTT[G/T]
GTTTTTATTTTATTTTATTTTGAATTTTGATTAATCTCGTATTCGGTTCTTATATGAAAACTTATTTCAATATTGCTTATTTTTAATTCTGAATTTCAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.90% 4.60% 0.06% 1.46% NA
All Indica  2759 97.50% 1.10% 0.00% 1.41% NA
All Japonica  1512 96.80% 1.20% 0.07% 1.98% NA
Aus  269 39.00% 60.20% 0.74% 0.00% NA
Indica I  595 99.20% 0.70% 0.00% 0.17% NA
Indica II  465 93.80% 0.00% 0.00% 6.24% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 3.10% 0.00% 1.15% NA
Temperate Japonica  767 96.10% 0.10% 0.00% 3.78% NA
Tropical Japonica  504 96.40% 3.40% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335759426 C -> A LOC_Os03g63270.1 downstream_gene_variant ; 1371.0bp to feature; MODIFIER silent_mutation Average:25.94; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0335759426 C -> A LOC_Os03g63270-LOC_Os03g63280 intergenic_region ; MODIFIER silent_mutation Average:25.94; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0335759426 C -> DEL N N silent_mutation Average:25.94; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335759426 NA 3.48E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426 NA 2.48E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426 NA 1.83E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426 NA 7.89E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426 2.47E-08 NA mr1249 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426 NA 5.11E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426 NA 9.16E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426 9.26E-07 NA mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335759426 1.95E-06 NA mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251