Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335754446:

Variant ID: vg0335754446 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35754446
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAATCCTCTTTGAACAAGTTACGTAGCCTGACGGCGACCGGTTAACCAAACCCGCGTGATTACTGATTAGATTACCATACCAGTAATAGTTTATTTAC[C/G]
TAGTCAGTCTAGATTACAACACAAAGACACGGTCCTGCCTCTATGCTAATGCTCGCCATTGACACCTGCTTTCTTGCTCCCATCTTCTCCCCTTTCTCCC

Reverse complement sequence

GGGAGAAAGGGGAGAAGATGGGAGCAAGAAAGCAGGTGTCAATGGCGAGCATTAGCATAGAGGCAGGACCGTGTCTTTGTGTTGTAATCTAGACTGACTA[G/C]
GTAAATAAACTATTACTGGTATGGTAATCTAATCAGTAATCACGCGGGTTTGGTTAACCGGTCGCCGTCAGGCTACGTAACTTGTTCAAAGAGGATTCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	30.00%	0.28%	0.00%	NA
All Indica	2759	77.70%	22.00%	0.33%	0.00%	NA
All Japonica	1512	54.60%	45.40%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	80.30%	19.30%	0.34%	0.00%	NA
Indica II	465	50.10%	49.50%	0.43%	0.00%	NA
Indica III	913	86.50%	13.30%	0.22%	0.00%	NA
Indica Intermediate	786	81.80%	17.80%	0.38%	0.00%	NA
Temperate Japonica	767	90.10%	9.90%	0.00%	0.00%	NA
Tropical Japonica	504	9.70%	90.30%	0.00%	0.00%	NA
Japonica Intermediate	241	35.30%	64.30%	0.41%	0.00%	NA
VI/Aromatic	96	6.20%	91.70%	2.08%	0.00%	NA
Intermediate	90	56.70%	42.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335754446	C -> G	LOC_Os03g63270.1	intron_variant ; MODIFIER	silent_mutation	Average:97.988; most accessible tissue: Callus, score: 99.95	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0335754446	C	G	0.05	0.02	0.0	0.01	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335754446	NA	6.33E-08	mr1536	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335754446	NA	9.38E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335754446	NA	1.95E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335754446	NA	3.00E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335754446	NA	5.80E-09	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335754446	NA	1.80E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335754446	NA	1.52E-08	mr1536_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335754446	NA	2.83E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335754446	NA	4.86E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335754446	NA	1.25E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251